Incidental Mutation 'R1255:Slc47a1'
ID151425
Institutional Source Beutler Lab
Gene Symbol Slc47a1
Ensembl Gene ENSMUSG00000010122
Gene Namesolute carrier family 47, member 1
SynonymsmMATE1, 1300013J15Rik, MATE1
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61343401-61378345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61370148 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 142 (L142Q)
Ref Sequence ENSEMBL: ENSMUSP00000115132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010267] [ENSMUST00000131723] [ENSMUST00000148671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010267
AA Change: L142Q

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122
AA Change: L142Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131723
AA Change: L142Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115132
Gene: ENSMUSG00000010122
AA Change: L142Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 180 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147583
Predicted Effect possibly damaging
Transcript: ENSMUST00000148671
AA Change: L92Q

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118265
Gene: ENSMUSG00000010122
AA Change: L92Q

DomainStartEndE-ValueType
Pfam:MatE 1 154 4.5e-30 PFAM
transmembrane domain 164 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It encodes a protein of unknown function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased blood urea nitrogen, increased circulating creatinine, and abnormal metformin pahrmacokinetics including increased plasma and tissue concentration with decreased kidney and liver clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Slc47a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Slc47a1 APN 11 61370124 missense probably damaging 1.00
IGL02399:Slc47a1 APN 11 61363058 missense probably damaging 1.00
IGL02586:Slc47a1 APN 11 61344321 missense probably benign 0.14
IGL02832:Slc47a1 APN 11 61363413 missense probably benign 0.01
IGL02873:Slc47a1 APN 11 61362817 unclassified probably benign
IGL03038:Slc47a1 APN 11 61353092 missense probably benign 0.14
R0392:Slc47a1 UTSW 11 61371782 missense probably damaging 1.00
R0927:Slc47a1 UTSW 11 61373422 missense probably damaging 0.96
R1507:Slc47a1 UTSW 11 61359518 critical splice donor site probably null
R1625:Slc47a1 UTSW 11 61371799 missense probably damaging 1.00
R2029:Slc47a1 UTSW 11 61378007 intron probably benign
R2137:Slc47a1 UTSW 11 61344492 missense probably benign 0.21
R2434:Slc47a1 UTSW 11 61367722 splice site probably null
R3115:Slc47a1 UTSW 11 61367680 missense possibly damaging 0.88
R3752:Slc47a1 UTSW 11 61344381 missense possibly damaging 0.84
R3839:Slc47a1 UTSW 11 61353058 splice site probably benign
R4499:Slc47a1 UTSW 11 61359529 missense probably benign
R4516:Slc47a1 UTSW 11 61344513 missense probably benign
R4675:Slc47a1 UTSW 11 61363031 missense probably benign 0.41
R4727:Slc47a1 UTSW 11 61363451 missense possibly damaging 0.48
R4839:Slc47a1 UTSW 11 61373350 splice site probably null
R4869:Slc47a1 UTSW 11 61362694 missense probably benign 0.02
R5164:Slc47a1 UTSW 11 61353060 splice site probably null
R5633:Slc47a1 UTSW 11 61369261 missense probably damaging 1.00
R5957:Slc47a1 UTSW 11 61344342 missense probably benign 0.06
R6793:Slc47a1 UTSW 11 61359403 missense probably benign
R6952:Slc47a1 UTSW 11 61344454 missense probably benign 0.04
R7082:Slc47a1 UTSW 11 61377941 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGGGAAGAGTCAGCCAAGATCAAC -3'
(R):5'- CCTGCACTAGCCATGTGTAGCATC -3'

Sequencing Primer
(F):5'- AACTTAAGCTCACCTTGGTGTG -3'
(R):5'- gcagcaagcccatctctc -3'
Posted On2014-01-29