Incidental Mutation 'R1255:Atxn3'
ID151427
Institutional Source Beutler Lab
Gene Symbol Atxn3
Ensembl Gene ENSMUSG00000021189
Gene Nameataxin 3
SynonymsSca3, ataxin-3, Atx3, MJD1, 2210008M02Rik, Mjd
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101918901-101958246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101934334 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 230 (Q230L)
Ref Sequence ENSEMBL: ENSMUSP00000125082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021606] [ENSMUST00000159883] [ENSMUST00000160251] [ENSMUST00000161011]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021606
AA Change: Q230L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021606
Gene: ENSMUSG00000021189
AA Change: Q230L

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
UIM 329 348 7.34e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159883
AA Change: Q226L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124419
Gene: ENSMUSG00000021189
AA Change: Q226L

DomainStartEndE-ValueType
Josephin 5 164 1.1e-89 SMART
UIM 220 239 2.23e-1 SMART
UIM 240 259 1.51e-3 SMART
low complexity region 272 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160186
AA Change: Q7L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124178
Gene: ENSMUSG00000021189
AA Change: Q7L

DomainStartEndE-ValueType
UIM 2 21 2.23e-1 SMART
UIM 22 41 1.51e-3 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160251
AA Change: Q230L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125082
Gene: ENSMUSG00000021189
AA Change: Q230L

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 8.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161011
AA Change: Q230L

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125378
Gene: ENSMUSG00000021189
AA Change: Q230L

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Decreased exploratory behavior is reported for mice homozygous for a disruption of this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Atxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Atxn3 APN 12 101926508 missense possibly damaging 0.94
IGL01364:Atxn3 APN 12 101934423 splice site probably benign
IGL01393:Atxn3 APN 12 101933047 nonsense probably null
IGL01994:Atxn3 APN 12 101942180 missense probably benign
IGL03214:Atxn3 APN 12 101945922 splice site probably benign
R1081:Atxn3 UTSW 12 101934349 missense probably damaging 0.98
R1288:Atxn3 UTSW 12 101942178 synonymous probably null
R1435:Atxn3 UTSW 12 101942201 missense probably benign 0.18
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R2032:Atxn3 UTSW 12 101942194 nonsense probably null
R2345:Atxn3 UTSW 12 101948321 missense probably damaging 1.00
R2882:Atxn3 UTSW 12 101937411 missense probably damaging 1.00
R4593:Atxn3 UTSW 12 101923177 missense probably benign 0.01
R4628:Atxn3 UTSW 12 101923078 unclassified probably benign
R4849:Atxn3 UTSW 12 101934368 missense probably benign 0.02
R4876:Atxn3 UTSW 12 101948379 missense probably damaging 1.00
R4960:Atxn3 UTSW 12 101948379 missense possibly damaging 0.92
R5682:Atxn3 UTSW 12 101958147 missense probably damaging 1.00
R6010:Atxn3 UTSW 12 101948026 missense probably damaging 1.00
R6520:Atxn3 UTSW 12 101934401 missense probably damaging 1.00
R6629:Atxn3 UTSW 12 101937406 missense probably benign 0.11
R7460:Atxn3 UTSW 12 101926517 missense probably benign 0.15
R7546:Atxn3 UTSW 12 101948002 critical splice donor site probably null
X0061:Atxn3 UTSW 12 101958139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACGTTAAGGACGTGATCCACTTCTC -3'
(R):5'- TCAGCACTCAGTTGTTGTTAGTAGACCT -3'

Sequencing Primer
(F):5'- GACGTGATCCACTTCTCCAAAAATG -3'
(R):5'- cacccacctgctcgctc -3'
Posted On2014-01-29