Incidental Mutation 'R1255:Spz1'
ID151429
Institutional Source Beutler Lab
Gene Symbol Spz1
Ensembl Gene ENSMUSG00000046957
Gene Namespermatogenic leucine zipper 1
Synonyms
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location92574636-92576172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92575630 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 113 (V113F)
Ref Sequence ENSEMBL: ENSMUSP00000054083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050658]
Predicted Effect probably benign
Transcript: ENSMUST00000050658
AA Change: V113F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054083
Gene: ENSMUSG00000046957
AA Change: V113F

DomainStartEndE-ValueType
coiled coil region 182 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bHLH-zip transcription factor which functions in the mitogen-activate protein kinase (MAPK) signaling pathway. Because of its role in the upregulation of cell proliferation and tumorigenesis, this gene may serve as a target for Ras-induced tumor treatments. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Spz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Spz1 APN 13 92575521 missense probably damaging 0.98
IGL01473:Spz1 APN 13 92575256 nonsense probably null
IGL01903:Spz1 APN 13 92574899 missense probably damaging 0.99
IGL02312:Spz1 APN 13 92575885 missense probably benign 0.01
IGL02343:Spz1 APN 13 92575546 missense probably benign 0.00
IGL02969:Spz1 APN 13 92575343 missense possibly damaging 0.82
R1756:Spz1 UTSW 13 92575125 missense probably damaging 0.96
R1992:Spz1 UTSW 13 92575658 missense possibly damaging 0.95
R3710:Spz1 UTSW 13 92575123 nonsense probably null
R4431:Spz1 UTSW 13 92575329 missense probably damaging 1.00
R5108:Spz1 UTSW 13 92575046 nonsense probably null
R5922:Spz1 UTSW 13 92575598 missense possibly damaging 0.81
R6724:Spz1 UTSW 13 92575484 missense possibly damaging 0.59
R7166:Spz1 UTSW 13 92575927 missense probably benign 0.00
R8145:Spz1 UTSW 13 92575101 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGTACTCTCCGCGAAGGTGAAG -3'
(R):5'- GAAATCGGATCACTCCCCACTGTC -3'

Sequencing Primer
(F):5'- GGTCTTTTCACGCTCAGCAG -3'
(R):5'- ACCAAAGAATAGCATCTGTCCAGTAG -3'
Posted On2014-01-29