Incidental Mutation 'R1256:Schip1'
ID151441
Institutional Source Beutler Lab
Gene Symbol Schip1
Ensembl Gene ENSMUSG00000027777
Gene Nameschwannomin interacting protein 1
SynonymsSCHIP-1
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R1256 (G1)
Quality Score166
Status Not validated
Chromosome3
Chromosomal Location68064802-68626481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68495042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 151 (I151F)
Ref Sequence ENSEMBL: ENSMUSP00000142090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029346] [ENSMUST00000169909] [ENSMUST00000182006] [ENSMUST00000182532] [ENSMUST00000182719] [ENSMUST00000192555]
Predicted Effect probably benign
Transcript: ENSMUST00000029346
AA Change: I179F

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029346
Gene: ENSMUSG00000027777
AA Change: I179F

DomainStartEndE-ValueType
low complexity region 33 49 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 95 113 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
low complexity region 186 198 N/A INTRINSIC
Pfam:SCHIP-1 252 481 3.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169909
SMART Domains Protein: ENSMUSP00000129152
Gene: ENSMUSG00000027777

DomainStartEndE-ValueType
Pfam:SCHIP-1 20 256 4.3e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182006
AA Change: I254F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138212
Gene: ENSMUSG00000102422
AA Change: I254F

DomainStartEndE-ValueType
Pfam:IQ-like 1 97 1e-54 PFAM
low complexity region 108 124 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 261 273 N/A INTRINSIC
Pfam:SCHIP-1 323 559 9.8e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182532
AA Change: I151F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138245
Gene: ENSMUSG00000027777
AA Change: I151F

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 456 6.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182719
AA Change: I151F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138207
Gene: ENSMUSG00000027777
AA Change: I151F

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 456 6.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192555
AA Change: I151F

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142090
Gene: ENSMUSG00000027777
AA Change: I151F

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 388 1.1e-103 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects and defective cell mirgration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Schip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Schip1 APN 3 68617777 missense probably damaging 1.00
IGL03354:Schip1 APN 3 68494965 missense possibly damaging 0.94
R0190:Schip1 UTSW 3 68625844 missense probably benign 0.09
R0413:Schip1 UTSW 3 68494613 missense probably damaging 1.00
R1777:Schip1 UTSW 3 68617684 missense probably damaging 1.00
R2067:Schip1 UTSW 3 68617786 missense probably damaging 1.00
R3027:Schip1 UTSW 3 68494610 missense probably damaging 1.00
R4258:Schip1 UTSW 3 68618630 missense possibly damaging 0.88
R4646:Schip1 UTSW 3 68064964 missense probably benign
R4917:Schip1 UTSW 3 68408485 intron probably benign
R4918:Schip1 UTSW 3 68408485 intron probably benign
R5021:Schip1 UTSW 3 68495252 missense probably benign 0.03
R5194:Schip1 UTSW 3 68494872 missense probably benign 0.15
R5225:Schip1 UTSW 3 68494937 missense probably benign
R5719:Schip1 UTSW 3 68408227 intron probably benign
R6460:Schip1 UTSW 3 68494894 missense probably benign 0.37
R7189:Schip1 UTSW 3 68617699 missense probably damaging 1.00
R7189:Schip1 UTSW 3 68617700 missense probably damaging 1.00
R7727:Schip1 UTSW 3 68064984 missense probably benign 0.09
R7757:Schip1 UTSW 3 68617695 missense probably damaging 0.99
R7793:Schip1 UTSW 3 68494578 missense probably benign 0.00
R8496:Schip1 UTSW 3 68494613 missense probably damaging 1.00
R8500:Schip1 UTSW 3 68494613 missense probably damaging 1.00
R8904:Schip1 UTSW 3 68495103 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGCAAATCCTCATCGTCGCC -3'
(R):5'- AGATGCTTTTCCAATGCCTCCCAG -3'

Sequencing Primer
(F):5'- ggggaggaggaggaagag -3'
(R):5'- AATGCCTCCCAGTCCATTG -3'
Posted On2014-01-29