Incidental Mutation 'R1256:Psip1'
ID151447
Institutional Source Beutler Lab
Gene Symbol Psip1
Ensembl Gene ENSMUSG00000028484
Gene NamePC4 and SFRS1 interacting protein 1
SynonymsPsip2
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location83455680-83486459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83474367 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 102 (S102P)
Ref Sequence ENSEMBL: ENSMUSP00000102833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030207] [ENSMUST00000107214] [ENSMUST00000107215] [ENSMUST00000130626]
Predicted Effect probably benign
Transcript: ENSMUST00000030207
AA Change: S102P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030207
Gene: ENSMUSG00000028484
AA Change: S102P

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
Pfam:LEDGF 347 448 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107214
AA Change: S102P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102832
Gene: ENSMUSG00000028484
AA Change: S102P

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107215
AA Change: S102P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102833
Gene: ENSMUSG00000028484
AA Change: S102P

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 316 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130626
SMART Domains Protein: ENSMUSP00000121950
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene tend to die perinatally. Survivors show reduced fertility and a variety of skeletal and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Psip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Psip1 APN 4 83468637 missense probably benign 0.00
IGL02801:Psip1 APN 4 83458120 missense probably benign 0.02
IGL02995:Psip1 APN 4 83463717 intron probably benign
IGL03070:Psip1 APN 4 83465081 missense probably damaging 0.99
IGL03381:Psip1 APN 4 83485785 missense probably benign 0.03
R0167:Psip1 UTSW 4 83466818 splice site probably null
R0288:Psip1 UTSW 4 83464959 missense probably damaging 1.00
R0365:Psip1 UTSW 4 83485712 splice site probably null
R0514:Psip1 UTSW 4 83460037 missense probably damaging 1.00
R0590:Psip1 UTSW 4 83458144 missense probably benign 0.00
R0734:Psip1 UTSW 4 83463588 intron probably benign
R0774:Psip1 UTSW 4 83460452 frame shift probably null
R1016:Psip1 UTSW 4 83459898 missense possibly damaging 0.48
R1819:Psip1 UTSW 4 83458163 missense probably benign 0.01
R1993:Psip1 UTSW 4 83482532 missense probably damaging 0.99
R5423:Psip1 UTSW 4 83460130 intron probably benign
R5940:Psip1 UTSW 4 83476322 missense probably damaging 1.00
R6173:Psip1 UTSW 4 83473049 splice site probably null
R6200:Psip1 UTSW 4 83474373 missense probably benign 0.20
R6809:Psip1 UTSW 4 83468642 missense probably benign 0.00
R7488:Psip1 UTSW 4 83473038 critical splice donor site probably null
R8021:Psip1 UTSW 4 83459955 missense possibly damaging 0.75
R8516:Psip1 UTSW 4 83466715 missense probably benign
RF005:Psip1 UTSW 4 83460498 missense probably damaging 1.00
RF024:Psip1 UTSW 4 83460498 missense probably damaging 1.00
Z1176:Psip1 UTSW 4 83459874 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AACTGTGAAATCCACAGGCAGTACTC -3'
(R):5'- CAGTAGTGCCACTCCCTGATGTAAAAC -3'

Sequencing Primer
(F):5'- AGGCAGTACTCAGAGACCC -3'
(R):5'- AACTTTAATGAGCAGTGGTGC -3'
Posted On2014-01-29