Incidental Mutation 'R1256:Brat1'
ID151448
Institutional Source Beutler Lab
Gene Symbol Brat1
Ensembl Gene ENSMUSG00000000148
Gene NameBRCA1-associated ATM activator 1
Synonyms
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location140705011-140719379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140710207 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 66 (Q66R)
Ref Sequence ENSEMBL: ENSMUSP00000106429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041588] [ENSMUST00000100505] [ENSMUST00000110806] [ENSMUST00000153440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041588
AA Change: Q66R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036016
Gene: ENSMUSG00000000148
AA Change: Q66R

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 3e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100505
AA Change: Q111R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098074
Gene: ENSMUSG00000000148
AA Change: Q111R

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
Pfam:HEAT 546 576 4.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110806
AA Change: Q66R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106429
Gene: ENSMUSG00000000148
AA Change: Q66R

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131905
Predicted Effect possibly damaging
Transcript: ENSMUST00000153440
AA Change: Q66R

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114216
Gene: ENSMUSG00000000148
AA Change: Q66R

DomainStartEndE-ValueType
SCOP:d1gw5a_ 2 172 2e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: A similar gene in human encodes a Breast Cancer 1 (BRCA1) interacting protein that is involved in cell cycle checkpoint signaling. The similar human protein is localized to DNA double strand breaks caused by ionizing radiation, and regulates cellular DNA damage response through interactions with Ataxia Telangiectasia Mutated (ATM) and DNA-dependent Protein Kinase. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Brat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Brat1 APN 5 140717177 missense probably damaging 1.00
IGL01327:Brat1 APN 5 140718208 nonsense probably null
IGL01897:Brat1 APN 5 140717915 missense probably benign 0.00
IGL01965:Brat1 APN 5 140718056 missense probably benign 0.01
IGL02437:Brat1 APN 5 140712808 missense possibly damaging 0.91
IGL03350:Brat1 APN 5 140705995 missense probably damaging 1.00
R0394:Brat1 UTSW 5 140718386 missense probably damaging 1.00
R1426:Brat1 UTSW 5 140718013 missense probably benign 0.00
R1474:Brat1 UTSW 5 140712627 missense probably benign
R1848:Brat1 UTSW 5 140718509 missense possibly damaging 0.94
R2205:Brat1 UTSW 5 140705133 intron probably benign
R3901:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R3902:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R4467:Brat1 UTSW 5 140705071 utr 5 prime probably benign
R4751:Brat1 UTSW 5 140718296 missense probably damaging 1.00
R5795:Brat1 UTSW 5 140713072 missense probably benign 0.01
R6151:Brat1 UTSW 5 140705961 missense probably benign 0.00
R7162:Brat1 UTSW 5 140710249 missense probably benign 0.00
R8247:Brat1 UTSW 5 140713138 missense possibly damaging 0.88
X0026:Brat1 UTSW 5 140714938 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGCCATTGTTGTACATACCCATCT -3'
(R):5'- ACAGACAAAGCATCAGGAGTGTCCTA -3'

Sequencing Primer
(F):5'- GTTGTACATACCCATCTTTCTTGGAC -3'
(R):5'- GTCCCTGGCAAATGTTTCTAAG -3'
Posted On2014-01-29