Incidental Mutation 'R1256:Ezh2'
ID151449
Institutional Source Beutler Lab
Gene Symbol Ezh2
Ensembl Gene ENSMUSG00000029687
Gene Nameenhancer of zeste 2 polycomb repressive complex 2 subunit
SynonymsEnx-1, KMT6, Enx1h
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location47530139-47595341 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 47541855 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 545 (C545*)
Ref Sequence ENSEMBL: ENSMUSP00000110265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618] [ENSMUST00000169889] [ENSMUST00000204798]
Predicted Effect probably null
Transcript: ENSMUST00000081721
AA Change: C549*
SMART Domains Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: C549*

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.1e-18 PFAM
SANT 159 250 9.7e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 555 592 1.05e-1 SMART
SET 612 733 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092648
SMART Domains Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.9e-20 PFAM
SANT 159 250 9.7e-3 SMART
Blast:SET 272 333 3e-13 BLAST
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 513 550 1.05e-1 SMART
SET 570 691 4.15e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114616
AA Change: C510*
SMART Domains Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: C510*

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
SANT 120 211 9.7e-3 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 346 370 N/A INTRINSIC
SANT 389 437 6.62e-1 SMART
CXC 516 553 1.05e-1 SMART
SET 573 694 4.15e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114618
AA Change: C545*
SMART Domains Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: C545*

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 7.4e-20 PFAM
SANT 150 241 9.7e-3 SMART
low complexity region 345 362 N/A INTRINSIC
low complexity region 381 405 N/A INTRINSIC
SANT 424 472 6.62e-1 SMART
CXC 551 588 1.05e-1 SMART
SET 608 729 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164006
SMART Domains Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 96 1e-16 BLAST
low complexity region 98 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165492
Predicted Effect probably benign
Transcript: ENSMUST00000167278
SMART Domains Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169889
SMART Domains Protein: ENSMUSP00000126481
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Blast:SET 18 150 3e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181519
Predicted Effect probably benign
Transcript: ENSMUST00000204243
Predicted Effect probably benign
Transcript: ENSMUST00000204798
SMART Domains Protein: ENSMUSP00000144780
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Ezh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Ezh2 APN 6 47556055 nonsense probably null
IGL01932:Ezh2 APN 6 47532048 missense probably damaging 0.99
IGL02019:Ezh2 APN 6 47551901 splice site probably null
IGL02748:Ezh2 APN 6 47558239 missense probably damaging 1.00
IGL02749:Ezh2 APN 6 47533764 missense probably damaging 0.99
IGL03171:Ezh2 APN 6 47540781 nonsense probably null
Peezy UTSW 6 47533758 nonsense probably null
R0417:Ezh2 UTSW 6 47551726 missense probably benign 0.00
R1587:Ezh2 UTSW 6 47552490 critical splice acceptor site probably null
R1631:Ezh2 UTSW 6 47577658 start codon destroyed probably null 0.01
R1736:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R1775:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R2076:Ezh2 UTSW 6 47576633 nonsense probably null
R2311:Ezh2 UTSW 6 47558260 missense probably damaging 1.00
R3751:Ezh2 UTSW 6 47556064 missense possibly damaging 0.94
R4016:Ezh2 UTSW 6 47544582 missense probably benign
R4119:Ezh2 UTSW 6 47544548 missense probably benign 0.00
R4214:Ezh2 UTSW 6 47533814 missense probably damaging 1.00
R4770:Ezh2 UTSW 6 47540696 missense probably damaging 1.00
R5133:Ezh2 UTSW 6 47540750 missense probably damaging 1.00
R5137:Ezh2 UTSW 6 47532080 splice site probably null
R5199:Ezh2 UTSW 6 47551725 missense probably benign 0.01
R5343:Ezh2 UTSW 6 47576615 missense probably damaging 1.00
R5584:Ezh2 UTSW 6 47532016 missense probably damaging 1.00
R5942:Ezh2 UTSW 6 47577582 missense possibly damaging 0.94
R6057:Ezh2 UTSW 6 47552423 missense probably damaging 1.00
R7247:Ezh2 UTSW 6 47533774 missense probably damaging 1.00
R7284:Ezh2 UTSW 6 47544519 missense probably benign 0.00
R7365:Ezh2 UTSW 6 47533758 nonsense probably null
R7382:Ezh2 UTSW 6 47551836 missense possibly damaging 0.55
R7718:Ezh2 UTSW 6 47554191 missense probably benign
R7910:Ezh2 UTSW 6 47556143 missense probably damaging 0.96
R8206:Ezh2 UTSW 6 47532900 critical splice donor site probably null
R8428:Ezh2 UTSW 6 47545811 nonsense probably null
R8746:Ezh2 UTSW 6 47576600 missense probably damaging 0.99
R8836:Ezh2 UTSW 6 47554262 missense probably benign
R8927:Ezh2 UTSW 6 47533779 missense possibly damaging 0.89
X0021:Ezh2 UTSW 6 47554169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTGCCCAAGAGGCTGACTAGAC -3'
(R):5'- TTCAGTAAAGGCAGCCAGTCAAGG -3'

Sequencing Primer
(F):5'- AGGCTGACTAGACATTAGCAC -3'
(R):5'- AGCCAGTCAAGGATGTTCC -3'
Posted On2014-01-29