Incidental Mutation 'R1256:Spn'
ID151455
Institutional Source Beutler Lab
Gene Symbol Spn
Ensembl Gene ENSMUSG00000051457
Gene Namesialophorin
SynonymsA630014B01Rik, Galgp, Ly48, Cd43, 3E8 antigen, leukosialin, Ly-48
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127132232-127137823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127136273 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 354 (K354R)
Ref Sequence ENSEMBL: ENSMUSP00000122787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049931] [ENSMUST00000143713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049931
AA Change: K354R

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049534
Gene: ENSMUSG00000051457
AA Change: K354R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 205 241 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143713
AA Change: K354R

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122787
Gene: ENSMUSG00000051457
AA Change: K354R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 205 241 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205483
AA Change: K98R
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major sialoglycoprotein found on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and some B lymphocytes. It may be part of a physiologic ligand-receptor complex involved in T-cell activation. During T-cell activation, this protein is actively removed from the T-cell-APC (antigen-presenting cell) contact site, suggesting a negative regulatory role in adaptive immune response. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show increased T cell proliferation in response to various stimulation agents and natural antigens, enhanced homotypic adhesion, transient resistance to melanoma growth and metastasis, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Spn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Spn APN 7 127136520 missense probably damaging 0.96
IGL02956:Spn APN 7 127137260 missense probably damaging 1.00
IGL03352:Spn APN 7 127137006 missense probably benign 0.00
PIT4520001:Spn UTSW 7 127136439 missense probably damaging 1.00
R0055:Spn UTSW 7 127136322 missense possibly damaging 0.94
R0624:Spn UTSW 7 127136208 missense possibly damaging 0.52
R0905:Spn UTSW 7 127136331 missense probably damaging 0.96
R2055:Spn UTSW 7 127137216 missense probably damaging 0.96
R2084:Spn UTSW 7 127137038 missense probably benign 0.00
R2105:Spn UTSW 7 127136241 missense probably damaging 0.99
R2251:Spn UTSW 7 127137159 missense probably benign 0.19
R5031:Spn UTSW 7 127137230 missense probably benign
R6146:Spn UTSW 7 127136307 missense possibly damaging 0.72
R6362:Spn UTSW 7 127136723 missense possibly damaging 0.55
R7353:Spn UTSW 7 127137006 missense probably benign 0.00
R7583:Spn UTSW 7 127137062 missense probably damaging 0.99
R8507:Spn UTSW 7 127136556 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACAAATGCAGAGTGTGCGGC -3'
(R):5'- TGAGATGCATGGACTCCCTGCTAC -3'

Sequencing Primer
(F):5'- AGTGTGCGGCAGCTAAC -3'
(R):5'- GCACCTCAGTTTCCAGCAG -3'
Posted On2014-01-29