Incidental Mutation 'R1256:Cnot10'
ID151461
Institutional Source Beutler Lab
Gene Symbol Cnot10
Ensembl Gene ENSMUSG00000056167
Gene NameCCR4-NOT transcription complex, subunit 10
Synonyms
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location114585878-114640184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114610681 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 520 (S520Y)
Ref Sequence ENSEMBL: ENSMUSP00000064840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000215155] [ENSMUST00000217148]
Predicted Effect probably damaging
Transcript: ENSMUST00000070117
AA Change: S520Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167
AA Change: S520Y

DomainStartEndE-ValueType
Blast:TPR 27 60 2e-10 BLAST
coiled coil region 73 107 N/A INTRINSIC
TPR 110 143 4.32e1 SMART
low complexity region 182 198 N/A INTRINSIC
TPR 293 326 3.37e-2 SMART
TPR 355 388 6.75e1 SMART
low complexity region 496 508 N/A INTRINSIC
TPR 643 676 7.87e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215155
Predicted Effect probably benign
Transcript: ENSMUST00000217148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217296
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Cnot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Cnot10 APN 9 114631855 missense probably benign 0.19
IGL02004:Cnot10 APN 9 114622930 missense probably damaging 1.00
IGL03297:Cnot10 APN 9 114598716 missense possibly damaging 0.87
BB003:Cnot10 UTSW 9 114617815 missense probably damaging 1.00
BB013:Cnot10 UTSW 9 114617815 missense probably damaging 1.00
R0348:Cnot10 UTSW 9 114598770 missense probably benign 0.10
R0390:Cnot10 UTSW 9 114629150 nonsense probably null
R1471:Cnot10 UTSW 9 114591551 missense probably benign 0.00
R1607:Cnot10 UTSW 9 114629095 nonsense probably null
R1721:Cnot10 UTSW 9 114614999 missense probably benign
R1741:Cnot10 UTSW 9 114597824 missense possibly damaging 0.87
R2116:Cnot10 UTSW 9 114626436 missense probably damaging 1.00
R4073:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4074:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4075:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4365:Cnot10 UTSW 9 114631881 nonsense probably null
R4383:Cnot10 UTSW 9 114631881 nonsense probably null
R4385:Cnot10 UTSW 9 114631881 nonsense probably null
R4398:Cnot10 UTSW 9 114631881 nonsense probably null
R4423:Cnot10 UTSW 9 114617920 missense probably damaging 1.00
R4859:Cnot10 UTSW 9 114627464 missense probably damaging 1.00
R4916:Cnot10 UTSW 9 114629134 missense possibly damaging 0.72
R4927:Cnot10 UTSW 9 114617944 missense probably damaging 1.00
R5153:Cnot10 UTSW 9 114613735 missense probably damaging 1.00
R5677:Cnot10 UTSW 9 114629093 missense probably damaging 1.00
R5702:Cnot10 UTSW 9 114629010 missense probably damaging 0.98
R5790:Cnot10 UTSW 9 114625917 splice site probably null
R6190:Cnot10 UTSW 9 114632723 missense probably damaging 1.00
R6353:Cnot10 UTSW 9 114597546 missense probably damaging 1.00
R6463:Cnot10 UTSW 9 114625902 missense probably damaging 1.00
R6819:Cnot10 UTSW 9 114615055 missense probably benign 0.10
R6849:Cnot10 UTSW 9 114631936 missense probably benign 0.01
R6875:Cnot10 UTSW 9 114615107 missense probably benign 0.00
R7071:Cnot10 UTSW 9 114617719 splice site probably null
R7408:Cnot10 UTSW 9 114631826 missense probably benign 0.33
R7412:Cnot10 UTSW 9 114625903 missense probably damaging 1.00
R7645:Cnot10 UTSW 9 114613637 missense probably benign
R7706:Cnot10 UTSW 9 114593438 missense probably damaging 0.98
R7926:Cnot10 UTSW 9 114617815 missense probably damaging 1.00
R8187:Cnot10 UTSW 9 114597488 nonsense probably null
R8322:Cnot10 UTSW 9 114627469 missense probably damaging 0.99
R8412:Cnot10 UTSW 9 114610670 missense probably benign 0.11
R8904:Cnot10 UTSW 9 114601355 missense probably benign 0.06
X0062:Cnot10 UTSW 9 114615134 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGTAGGATGCTCCCAGGCAGAAGAC -3'
(R):5'- GCTTTCATACTTGTTGGACGAGCACTC -3'

Sequencing Primer
(F):5'- CCCAGGCAGAAGACAGTGC -3'
(R):5'- gggaggcagaagaaagtgg -3'
Posted On2014-01-29