Incidental Mutation 'R1256:Kcnj16'
ID151465
Institutional Source Beutler Lab
Gene Symbol Kcnj16
Ensembl Gene ENSMUSG00000051497
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 16
Synonyms6430410F18Rik, Kir5.1
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110968033-111027968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111025436 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 308 (H308R)
Ref Sequence ENSEMBL: ENSMUSP00000136382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106635] [ENSMUST00000106636] [ENSMUST00000125692] [ENSMUST00000150902] [ENSMUST00000178798] [ENSMUST00000180023]
Predicted Effect probably damaging
Transcript: ENSMUST00000106635
AA Change: H308R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102246
Gene: ENSMUSG00000051497
AA Change: H308R

DomainStartEndE-ValueType
Pfam:IRK 37 357 9.3e-132 PFAM
low complexity region 371 383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106636
AA Change: H308R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102247
Gene: ENSMUSG00000051497
AA Change: H308R

DomainStartEndE-ValueType
Pfam:IRK 37 368 2e-145 PFAM
low complexity region 371 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125692
SMART Domains Protein: ENSMUSP00000119921
Gene: ENSMUSG00000051497

DomainStartEndE-ValueType
Pfam:IRK 37 103 3.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150902
SMART Domains Protein: ENSMUSP00000121758
Gene: ENSMUSG00000051497

DomainStartEndE-ValueType
Pfam:IRK 37 66 1.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178798
AA Change: H308R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137414
Gene: ENSMUSG00000051497
AA Change: H308R

DomainStartEndE-ValueType
Pfam:IRK 37 368 2e-145 PFAM
low complexity region 371 383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180023
AA Change: H308R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136382
Gene: ENSMUSG00000051497
AA Change: H308R

DomainStartEndE-ValueType
Pfam:IRK 37 368 2e-145 PFAM
low complexity region 371 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which tends to allow potassium to flow into rather than out of a cell, can form heterodimers with two other inward-rectifier type potassium channels. It may function in fluid and pH balance regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron response to ammonium chloride withdrawal and carbon dioxide treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Ccdc186 G T 19: 56,797,621 L661I probably benign Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Kcnj16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Kcnj16 APN 11 111025208 missense probably benign 0.15
IGL00596:Kcnj16 APN 11 111024523 missense probably damaging 0.99
IGL02152:Kcnj16 APN 11 111025210 missense probably benign 0.01
IGL02637:Kcnj16 APN 11 111025613 missense probably benign 0.13
R0054:Kcnj16 UTSW 11 111024723 missense probably damaging 1.00
R0054:Kcnj16 UTSW 11 111024723 missense probably damaging 1.00
R1557:Kcnj16 UTSW 11 111025241 missense possibly damaging 0.94
R1919:Kcnj16 UTSW 11 111024953 missense possibly damaging 0.86
R1985:Kcnj16 UTSW 11 111025583 missense probably benign 0.00
R2047:Kcnj16 UTSW 11 111025120 splice site probably null
R2504:Kcnj16 UTSW 11 111025583 missense probably benign 0.00
R3915:Kcnj16 UTSW 11 111025556 missense probably benign 0.34
R6102:Kcnj16 UTSW 11 111025577 missense probably benign 0.39
R6225:Kcnj16 UTSW 11 111025552 nonsense probably null
R6554:Kcnj16 UTSW 11 111025305 nonsense probably null
R6620:Kcnj16 UTSW 11 111024647 missense probably damaging 1.00
R7747:Kcnj16 UTSW 11 111024743 missense probably damaging 1.00
R7990:Kcnj16 UTSW 11 111025060 missense probably damaging 0.99
R8161:Kcnj16 UTSW 11 111024515 start codon destroyed probably null 0.99
R8414:Kcnj16 UTSW 11 111025615 missense probably benign
R8810:Kcnj16 UTSW 11 111024851 missense possibly damaging 0.91
X0021:Kcnj16 UTSW 11 111025127 missense probably damaging 1.00
Z1177:Kcnj16 UTSW 11 111024553 missense possibly damaging 0.74
Z1177:Kcnj16 UTSW 11 111025770 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATGAAATTGACCATGAGAGCCC -3'
(R):5'- CATGCTTACAGCTTCTGGCCCTTAG -3'

Sequencing Primer
(F):5'- ACCATGAGAGCCCTCTGTATG -3'
(R):5'- TCCTATTTAAAGTCAGGAGGGC -3'
Posted On2014-01-29