Mutagenetix > Incidental Mutation

Incidental Mutation 'R1256:Jag2'

151468

Institutional Source

Beutler Lab

Gene Symbol

Jag2

Ensembl Gene

ENSMUSG00000002799

Gene Name

jagged 2

Synonyms

Serh, D12Ggc2e

MMRRC Submission

039323-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1256 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112907819-112929776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112914419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 564 (E564G)

Ref Sequence

ENSEMBL: ENSMUSP00000075224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075827]

AlphaFold

Q9QYE5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075827
AA Change: E564G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: E564G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:MNNL	26	105	4.2e-31	PFAM
low complexity region	108	123	N/A	INTRINSIC
DSL	178	240	1.48e-36	SMART
EGF_like	244	274	7.23e1	SMART
EGF	275	305	4.56e0	SMART
EGF_CA	307	345	8.5e-9	SMART
EGF	350	383	4e-5	SMART
EGF_CA	385	421	5.39e-11	SMART
EGF_CA	423	459	3.51e-10	SMART
EGF_CA	461	496	1.01e-10	SMART
EGF_CA	498	534	1.17e-6	SMART
EGF_CA	536	572	6.35e-8	SMART
EGF	588	634	7.53e-1	SMART
EGF_CA	636	672	2.89e-11	SMART
EGF	677	710	3.68e-4	SMART
EGF	715	748	1.32e-5	SMART
EGF	754	787	1.34e-6	SMART
EGF_CA	789	825	2.58e-8	SMART
EGF_CA	827	863	7.23e-12	SMART
VWC	872	949	1.3e-1	SMART
low complexity region	1002	1035	N/A	INTRINSIC
transmembrane domain	1085	1107	N/A	INTRINSIC
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1170	1199	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220771

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220855

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221696

Predicted Effect

unknown
Transcript: ENSMUST00000223140
AA Change: E129G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223304

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Apaf1	A	G	10: 91,058,406	Y456H	probably benign	Het
Arhgef11	A	G	3: 87,727,135	N791S	possibly damaging	Het
Brat1	A	G	5: 140,710,207	Q66R	possibly damaging	Het
Capn10	C	T	1: 92,946,946	T633M	probably damaging	Het
Ccdc186	G	T	19: 56,797,621	L661I	probably benign	Het
Cln3	A	G	7: 126,583,036	S4P	probably damaging	Het
Cnot10	G	T	9: 114,610,681	S520Y	probably damaging	Het
Csmd1	A	T	8: 16,079,964	F1715I	probably damaging	Het
Dscr3	A	G	16: 94,512,366	L22P	probably damaging	Het
Ezh2	A	T	6: 47,541,855	C545*	probably null	Het
Hivep1	C	T	13: 42,181,831	S2282F	probably damaging	Het
Kcnj16	A	G	11: 111,025,436	H308R	probably damaging	Het
Kdelc2	A	C	9: 53,388,462	R90S	possibly damaging	Het
Magi3	C	T	3: 104,027,810	V936I	probably benign	Het
Mcu	G	T	10: 59,454,968	A279E	probably damaging	Het
Msln	A	G	17: 25,754,183	C13R	probably damaging	Het
Nes	A	G	3: 87,976,576	D714G	probably benign	Het
Nif3l1	T	A	1: 58,455,649	V259D	probably damaging	Het
Olfr1262	A	T	2: 90,002,567	M54L	possibly damaging	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr177	A	C	16: 58,872,843	Y102*	probably null	Het
Pcdhb9	A	G	18: 37,403,116	D721G	possibly damaging	Het
Pepd	A	C	7: 34,921,492	T61P	possibly damaging	Het
Pkd1l2	C	T	8: 117,019,543		probably null	Het
Psip1	A	G	4: 83,474,367	S102P	probably benign	Het
Ralgapa1	T	C	12: 55,762,661	E443G	possibly damaging	Het
Rnf20	A	G	4: 49,638,230	D114G	probably benign	Het
Schip1	A	T	3: 68,495,042	I151F	probably benign	Het
Smarca2	A	G	19: 26,681,973	I888V	probably benign	Het
Smg1	T	C	7: 118,203,087	T263A	probably damaging	Het
Spn	T	C	7: 127,136,273	K354R	possibly damaging	Het
Sspo	G	A	6: 48,457,639	A1022T	probably damaging	Het
Strn	A	C	17: 78,664,617		probably null	Het
Tstd3	T	C	4: 21,759,627	I79M	probably damaging	Het
Txnl4a	A	G	18: 80,207,272	I28V	probably benign	Het
Uty	T	C	Y: 1,134,884	D928G	probably damaging	Het
Vsx2	T	A	12: 84,576,311	L163Q	probably damaging	Het

Other mutations in Jag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Jag2	APN	12	112912718	missense	probably benign	0.20
IGL00954:Jag2	APN	12	112920406	missense	possibly damaging	0.50
IGL01532:Jag2	APN	12	112914363	missense	probably damaging	0.98
IGL01646:Jag2	APN	12	112916349	missense	possibly damaging	0.65
IGL02243:Jag2	APN	12	112916345	missense	possibly damaging	0.94
IGL02447:Jag2	APN	12	112912612	missense	probably damaging	1.00
IGL02458:Jag2	APN	12	112915993	missense	probably damaging	0.98
IGL02516:Jag2	APN	12	112910566	missense	probably damaging	1.00
IGL02574:Jag2	APN	12	112915511	missense	probably benign	0.32
IGL02629:Jag2	APN	12	112914514	splice site	probably benign
IGL02873:Jag2	APN	12	112910502	missense	probably benign	0.00
IGL03087:Jag2	APN	12	112913948	missense	possibly damaging	0.60
Jaguarundi	UTSW	12	112915469	critical splice donor site	probably null
R0068:Jag2	UTSW	12	112915193	splice site	probably benign
R0310:Jag2	UTSW	12	112913377	unclassified	probably benign
R0963:Jag2	UTSW	12	112915314	missense	probably damaging	1.00
R1188:Jag2	UTSW	12	112920121	nonsense	probably null
R1298:Jag2	UTSW	12	112916319	unclassified	probably benign
R1317:Jag2	UTSW	12	112914501	missense	probably benign
R2079:Jag2	UTSW	12	112920377	missense	probably damaging	1.00
R2345:Jag2	UTSW	12	112909064	missense	probably damaging	1.00
R4654:Jag2	UTSW	12	112913646	missense	probably benign	0.13
R4782:Jag2	UTSW	12	112914249	missense	probably benign
R4798:Jag2	UTSW	12	112916632	missense	probably benign	0.01
R5242:Jag2	UTSW	12	112916866	missense	probably damaging	0.97
R5350:Jag2	UTSW	12	112908922	missense	possibly damaging	0.77
R5364:Jag2	UTSW	12	112910534	missense	probably damaging	1.00
R6129:Jag2	UTSW	12	112920349	nonsense	probably null
R6362:Jag2	UTSW	12	112920122	missense	probably damaging	0.97
R6376:Jag2	UTSW	12	112909329	missense	probably benign	0.00
R6819:Jag2	UTSW	12	112910541	missense	probably damaging	1.00
R6844:Jag2	UTSW	12	112916714	missense	probably damaging	1.00
R6968:Jag2	UTSW	12	112914258	missense	probably benign	0.10
R7514:Jag2	UTSW	12	112929052	missense	probably benign	0.19
R7663:Jag2	UTSW	12	112913666	missense	probably damaging	1.00
R7730:Jag2	UTSW	12	112922041	missense	probably damaging	1.00
R7754:Jag2	UTSW	12	112915469	critical splice donor site	probably null
R7828:Jag2	UTSW	12	112913180	missense	probably benign	0.19
R7874:Jag2	UTSW	12	112915946	missense	probably damaging	0.99
R8075:Jag2	UTSW	12	112915274	missense	probably benign	0.05
R8845:Jag2	UTSW	12	112920094	missense	probably damaging	1.00
R8876:Jag2	UTSW	12	112909637	missense	probably benign	0.00
R9117:Jag2	UTSW	12	112913659	nonsense	probably null
R9400:Jag2	UTSW	12	112911988	nonsense	probably null
R9673:Jag2	UTSW	12	112911796	nonsense	probably null
R9688:Jag2	UTSW	12	112908944	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CACCACTCACTTTCATGGCAGTAGG -3'
(R):5'- AGCTGACGGTGCTCAGACATTC -3'

Sequencing Primer
(F):5'- TGAAGCCGCTGTCACAGATG -3'
(R):5'- AAGCTCAGCTTGGCACC -3'

Posted On

2014-01-29