Incidental Mutation 'R1256:Jag2'
ID 151468
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms D12Ggc2e, Serh
MMRRC Submission 039323-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1256 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 112871439-112893396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112878039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 564 (E564G)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect possibly damaging
Transcript: ENSMUST00000075827
AA Change: E564G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: E564G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect unknown
Transcript: ENSMUST00000223140
AA Change: E129G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223304
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Apaf1 A G 10: 90,894,268 (GRCm39) Y456H probably benign Het
Arhgef11 A G 3: 87,634,442 (GRCm39) N791S possibly damaging Het
Brat1 A G 5: 140,695,962 (GRCm39) Q66R possibly damaging Het
Capn10 C T 1: 92,874,668 (GRCm39) T633M probably damaging Het
Ccdc186 G T 19: 56,786,053 (GRCm39) L661I probably benign Het
Cln3 A G 7: 126,182,208 (GRCm39) S4P probably damaging Het
Cnot10 G T 9: 114,439,749 (GRCm39) S520Y probably damaging Het
Csmd1 A T 8: 16,129,978 (GRCm39) F1715I probably damaging Het
Ezh2 A T 6: 47,518,789 (GRCm39) C545* probably null Het
Hivep1 C T 13: 42,335,307 (GRCm39) S2282F probably damaging Het
Kcnj16 A G 11: 110,916,262 (GRCm39) H308R probably damaging Het
Magi3 C T 3: 103,935,126 (GRCm39) V936I probably benign Het
Mcu G T 10: 59,290,790 (GRCm39) A279E probably damaging Het
Msln A G 17: 25,973,157 (GRCm39) C13R probably damaging Het
Nes A G 3: 87,883,883 (GRCm39) D714G probably benign Het
Nif3l1 T A 1: 58,494,808 (GRCm39) V259D probably damaging Het
Or4c127 A T 2: 89,832,911 (GRCm39) M54L possibly damaging Het
Or5k14 A C 16: 58,693,206 (GRCm39) Y102* probably null Het
Or8g18 G C 9: 39,149,547 (GRCm39) P58A probably benign Het
Pcdhb9 A G 18: 37,536,169 (GRCm39) D721G possibly damaging Het
Pepd A C 7: 34,620,917 (GRCm39) T61P possibly damaging Het
Pkd1l2 C T 8: 117,746,282 (GRCm39) probably null Het
Poglut3 A C 9: 53,299,762 (GRCm39) R90S possibly damaging Het
Psip1 A G 4: 83,392,604 (GRCm39) S102P probably benign Het
Ralgapa1 T C 12: 55,809,446 (GRCm39) E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 (GRCm39) D114G probably benign Het
Schip1 A T 3: 68,402,375 (GRCm39) I151F probably benign Het
Smarca2 A G 19: 26,659,373 (GRCm39) I888V probably benign Het
Smg1 T C 7: 117,802,310 (GRCm39) T263A probably damaging Het
Spn T C 7: 126,735,445 (GRCm39) K354R possibly damaging Het
Sspo G A 6: 48,434,573 (GRCm39) A1022T probably damaging Het
Strn A C 17: 78,972,046 (GRCm39) probably null Het
Tstd3 T C 4: 21,759,627 (GRCm39) I79M probably damaging Het
Txnl4a A G 18: 80,250,487 (GRCm39) I28V probably benign Het
Uty T C Y: 1,134,884 (GRCm39) D928G probably damaging Het
Vps26c A G 16: 94,313,225 (GRCm39) L22P probably damaging Het
Vsx2 T A 12: 84,623,085 (GRCm39) L163Q probably damaging Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112,876,338 (GRCm39) missense probably benign 0.20
IGL00954:Jag2 APN 12 112,884,026 (GRCm39) missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112,877,983 (GRCm39) missense probably damaging 0.98
IGL01646:Jag2 APN 12 112,879,969 (GRCm39) missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112,879,965 (GRCm39) missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112,876,232 (GRCm39) missense probably damaging 1.00
IGL02458:Jag2 APN 12 112,879,613 (GRCm39) missense probably damaging 0.98
IGL02516:Jag2 APN 12 112,874,186 (GRCm39) missense probably damaging 1.00
IGL02574:Jag2 APN 12 112,879,131 (GRCm39) missense probably benign 0.32
IGL02629:Jag2 APN 12 112,878,134 (GRCm39) splice site probably benign
IGL02873:Jag2 APN 12 112,874,122 (GRCm39) missense probably benign 0.00
IGL03087:Jag2 APN 12 112,877,568 (GRCm39) missense possibly damaging 0.60
Jaguarundi UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R0068:Jag2 UTSW 12 112,878,813 (GRCm39) splice site probably benign
R0310:Jag2 UTSW 12 112,876,997 (GRCm39) unclassified probably benign
R0963:Jag2 UTSW 12 112,878,934 (GRCm39) missense probably damaging 1.00
R1188:Jag2 UTSW 12 112,883,741 (GRCm39) nonsense probably null
R1298:Jag2 UTSW 12 112,879,939 (GRCm39) unclassified probably benign
R1317:Jag2 UTSW 12 112,878,121 (GRCm39) missense probably benign
R2079:Jag2 UTSW 12 112,883,997 (GRCm39) missense probably damaging 1.00
R2345:Jag2 UTSW 12 112,872,684 (GRCm39) missense probably damaging 1.00
R4654:Jag2 UTSW 12 112,877,266 (GRCm39) missense probably benign 0.13
R4782:Jag2 UTSW 12 112,877,869 (GRCm39) missense probably benign
R4798:Jag2 UTSW 12 112,880,252 (GRCm39) missense probably benign 0.01
R5242:Jag2 UTSW 12 112,880,486 (GRCm39) missense probably damaging 0.97
R5350:Jag2 UTSW 12 112,872,542 (GRCm39) missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112,874,154 (GRCm39) missense probably damaging 1.00
R6129:Jag2 UTSW 12 112,883,969 (GRCm39) nonsense probably null
R6362:Jag2 UTSW 12 112,883,742 (GRCm39) missense probably damaging 0.97
R6376:Jag2 UTSW 12 112,872,949 (GRCm39) missense probably benign 0.00
R6819:Jag2 UTSW 12 112,874,161 (GRCm39) missense probably damaging 1.00
R6844:Jag2 UTSW 12 112,880,334 (GRCm39) missense probably damaging 1.00
R6968:Jag2 UTSW 12 112,877,878 (GRCm39) missense probably benign 0.10
R7514:Jag2 UTSW 12 112,892,672 (GRCm39) missense probably benign 0.19
R7663:Jag2 UTSW 12 112,877,286 (GRCm39) missense probably damaging 1.00
R7730:Jag2 UTSW 12 112,885,661 (GRCm39) missense probably damaging 1.00
R7754:Jag2 UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R7828:Jag2 UTSW 12 112,876,800 (GRCm39) missense probably benign 0.19
R7874:Jag2 UTSW 12 112,879,566 (GRCm39) missense probably damaging 0.99
R8075:Jag2 UTSW 12 112,878,894 (GRCm39) missense probably benign 0.05
R8845:Jag2 UTSW 12 112,883,714 (GRCm39) missense probably damaging 1.00
R8876:Jag2 UTSW 12 112,873,257 (GRCm39) missense probably benign 0.00
R9117:Jag2 UTSW 12 112,877,279 (GRCm39) nonsense probably null
R9400:Jag2 UTSW 12 112,875,608 (GRCm39) nonsense probably null
R9673:Jag2 UTSW 12 112,875,416 (GRCm39) nonsense probably null
R9688:Jag2 UTSW 12 112,872,564 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CACCACTCACTTTCATGGCAGTAGG -3'
(R):5'- AGCTGACGGTGCTCAGACATTC -3'

Sequencing Primer
(F):5'- TGAAGCCGCTGTCACAGATG -3'
(R):5'- AAGCTCAGCTTGGCACC -3'
Posted On 2014-01-29