Incidental Mutation 'R1257:Xkr4'
ID151481
Institutional Source Beutler Lab
Gene Symbol Xkr4
Ensembl Gene ENSMUSG00000051951
Gene NameX-linked Kx blood group related 4
Synonyms
MMRRC Submission 039324-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1257 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location3205901-3671498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3216813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 385 (I385L)
Ref Sequence ENSEMBL: ENSMUSP00000070648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070533]
Predicted Effect probably benign
Transcript: ENSMUST00000070533
AA Change: I385L

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070648
Gene: ENSMUSG00000051951
AA Change: I385L

DomainStartEndE-ValueType
low complexity region 49 99 N/A INTRINSIC
Pfam:XK-related 111 513 2.6e-128 PFAM
low complexity region 573 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162897
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A T 13: 98,984,515 M1K probably null Het
Acoxl A T 2: 128,044,366 T174S probably benign Het
Ank3 C T 10: 69,874,835 R408* probably null Het
Ceacam15 A G 7: 16,672,024 S201P possibly damaging Het
Ceacam20 A G 7: 19,974,192 I241V probably benign Het
Cfap46 A T 7: 139,654,629 L237* probably null Het
Col4a3 T A 1: 82,716,365 C133S probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Dnhd1 T A 7: 105,694,153 V1568D probably damaging Het
Fam208b T C 13: 3,575,049 T1634A probably benign Het
Gli3 C T 13: 15,725,996 Q1323* probably null Het
Gm884 A G 11: 103,534,641 V1462A unknown Het
Grhpr A G 4: 44,989,045 N287S probably damaging Het
Hectd4 G A 5: 121,318,624 W684* probably null Het
Kifc3 A G 8: 95,105,772 V474A probably damaging Het
Mdn1 A T 4: 32,667,089 probably null Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Nid1 T C 13: 13,483,790 Y707H probably benign Het
Nol4 A T 18: 22,770,681 N339K probably damaging Het
Olfr799 A T 10: 129,647,544 K139* probably null Het
Rbm34 C T 8: 126,970,893 G23S possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Snap25 A T 2: 136,758,348 E37V probably damaging Het
Taf1a A G 1: 183,397,837 T118A possibly damaging Het
Thrb T A 14: 18,008,642 I122K probably damaging Het
Zeb1 G T 18: 5,772,699 R996L possibly damaging Het
Other mutations in Xkr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Xkr4 APN 1 3216575 missense probably damaging 1.00
R0200:Xkr4 UTSW 1 3670663 missense probably benign 0.00
R0829:Xkr4 UTSW 1 3671246 missense possibly damaging 0.59
R0830:Xkr4 UTSW 1 3670745 missense possibly damaging 0.48
R0959:Xkr4 UTSW 1 3216674 missense probably damaging 1.00
R1242:Xkr4 UTSW 1 3216137 missense probably damaging 1.00
R2002:Xkr4 UTSW 1 3671095 missense probably benign
R3896:Xkr4 UTSW 1 3216191 missense probably damaging 0.99
R4006:Xkr4 UTSW 1 3421775 missense probably benign 0.01
R4173:Xkr4 UTSW 1 3216488 missense probably damaging 1.00
R4770:Xkr4 UTSW 1 3216491 missense probably damaging 1.00
R4868:Xkr4 UTSW 1 3216851 missense probably damaging 1.00
R5103:Xkr4 UTSW 1 3670688 missense probably benign
R5548:Xkr4 UTSW 1 3216930 missense probably damaging 1.00
R5602:Xkr4 UTSW 1 3216528 missense probably benign 0.18
R5608:Xkr4 UTSW 1 3671380 start gained probably benign
R5668:Xkr4 UTSW 1 3671035 missense probably damaging 1.00
R5901:Xkr4 UTSW 1 3216678 missense probably damaging 0.99
R6296:Xkr4 UTSW 1 3216570 missense probably benign 0.01
R6302:Xkr4 UTSW 1 3216738 missense probably damaging 0.99
R6326:Xkr4 UTSW 1 3671038 missense possibly damaging 0.75
R6341:Xkr4 UTSW 1 3670778 missense probably benign
R6911:Xkr4 UTSW 1 3671321 missense possibly damaging 0.91
R7086:Xkr4 UTSW 1 3216962 missense probably damaging 1.00
R7249:Xkr4 UTSW 1 3216810 missense probably damaging 1.00
R7571:Xkr4 UTSW 1 3670688 missense probably benign 0.00
R7881:Xkr4 UTSW 1 3216264 missense probably damaging 1.00
R7952:Xkr4 UTSW 1 3670619 missense possibly damaging 0.94
R8332:Xkr4 UTSW 1 3421899 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670981 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATGTAGATGATGCCCACCACC -3'
(R):5'- GCTATCTTGTCCCAAGACACCACG -3'

Sequencing Primer
(F):5'- TGATGCCCACCACCATGTC -3'
(R):5'- GTGGCTTGACCTCCCATAC -3'
Posted On2014-01-29