Mutagenetix > Incidental Mutation

Incidental Mutation 'R1257:Med7'

151499

Institutional Source

Beutler Lab

Gene Symbol

Med7

Ensembl Gene

ENSMUSG00000020397

Gene Name

mediator complex subunit 7

Synonyms

Crsp9, Crsp33, 1110063B05Rik

MMRRC Submission

039324-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R1257 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46327752-46333548 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 46331460 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 18 (I18M)

Ref Sequence

ENSEMBL: ENSMUSP00000131852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020665] [ENSMUST00000109231] [ENSMUST00000109232] [ENSMUST00000128940] [ENSMUST00000133635] [ENSMUST00000140027] [ENSMUST00000152119] [ENSMUST00000170928]

AlphaFold

Q9CZB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020665
AA Change: I18M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000020665
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	165	3.9e-51	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109231
AA Change: I18M

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000104854
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	165	3.6e-52	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109232
AA Change: I18M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104855
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	165	3.9e-51	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000128940
AA Change: I18M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116997
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	157	4.1e-50	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133635
AA Change: I18M

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120617
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	133	2.4e-43	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140027
AA Change: I18M

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120077
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	61	8.6e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152119
AA Change: I18M

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122182
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	6	93	6.7e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170928
AA Change: I18M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131852
Gene: ENSMUSG00000020397
AA Change: I18M

Domain	Start	End	E-Value	Type
Pfam:Med7	7	164	1.9e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156073

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181212

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	A	T	2: 127,886,286 (GRCm39)	T174S	probably benign	Het
Ank3	C	T	10: 69,710,665 (GRCm39)	R408*	probably null	Het
Ceacam15	A	G	7: 16,405,949 (GRCm39)	S201P	possibly damaging	Het
Ceacam20	A	G	7: 19,708,117 (GRCm39)	I241V	probably benign	Het
Cfap46	A	T	7: 139,234,545 (GRCm39)	L237*	probably null	Het
Col4a3	T	A	1: 82,694,086 (GRCm39)	C133S	probably damaging	Het
Dnajc9	G	A	14: 20,438,765 (GRCm39)		probably null	Het
Dnhd1	T	A	7: 105,343,360 (GRCm39)	V1568D	probably damaging	Het
Gli3	C	T	13: 15,900,581 (GRCm39)	Q1323*	probably null	Het
Grhpr	A	G	4: 44,989,045 (GRCm39)	N287S	probably damaging	Het
H2bl1	A	T	13: 99,121,023 (GRCm39)	M1K	probably null	Het
Hectd4	G	A	5: 121,456,687 (GRCm39)	W684*	probably null	Het
Kifc3	A	G	8: 95,832,400 (GRCm39)	V474A	probably damaging	Het
Lrrc37	A	G	11: 103,425,467 (GRCm39)	V1462A	unknown	Het
Mdn1	A	T	4: 32,667,089 (GRCm39)		probably null	Het
Nid1	T	C	13: 13,658,375 (GRCm39)	Y707H	probably benign	Het
Nol4	A	T	18: 22,903,738 (GRCm39)	N339K	probably damaging	Het
Or6c209	A	T	10: 129,483,413 (GRCm39)	K139*	probably null	Het
Rbm34	C	T	8: 127,697,643 (GRCm39)	G23S	possibly damaging	Het
Rps19bp1	CCTTCTTCTTCTTCTTCTTCTT	CCTTCTTCTTCTTCTTCTT	15: 80,145,250 (GRCm39)		probably benign	Het
Shf	G	A	2: 122,199,163 (GRCm39)	P51S	probably damaging	Het
Snap25	A	T	2: 136,600,268 (GRCm39)	E37V	probably damaging	Het
Taf1a	A	G	1: 183,179,175 (GRCm39)	T118A	possibly damaging	Het
Tasor2	T	C	13: 3,625,049 (GRCm39)	T1634A	probably benign	Het
Thrb	T	A	14: 18,008,642 (GRCm38)	I122K	probably damaging	Het
Xkr4	T	G	1: 3,287,036 (GRCm39)	I385L	probably benign	Het
Zeb1	G	T	18: 5,772,699 (GRCm39)	R996L	possibly damaging	Het

Other mutations in Med7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1259:Med7	UTSW	11	46,331,460 (GRCm39)	missense	probably damaging	0.96
R1260:Med7	UTSW	11	46,331,460 (GRCm39)	missense	probably damaging	0.96
R7216:Med7	UTSW	11	46,331,681 (GRCm39)	missense	probably damaging	1.00
R7255:Med7	UTSW	11	46,331,822 (GRCm39)	missense	probably damaging	0.98
R7683:Med7	UTSW	11	46,331,687 (GRCm39)	missense	possibly damaging	0.46
R8165:Med7	UTSW	11	46,332,073 (GRCm39)	missense	probably benign	0.12
R9406:Med7	UTSW	11	46,331,865 (GRCm39)	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TTTCCCGCAAGCCCCAGTAGATAG -3'
(R):5'- AGGATGAAGCCGTTCAATGCCC -3'

Sequencing Primer
(F):5'- ACTACTGTTGAAAACCCTGAGG -3'
(R):5'- CCTGACTTTCTAAAGGGCGAATG -3'

Posted On

2014-01-29