Incidental Mutation 'R1258:Zmat3'
ID151515
Institutional Source Beutler Lab
Gene Symbol Zmat3
Ensembl Gene ENSMUSG00000027663
Gene Namezinc finger matrin type 3
SynonymsWig1
MMRRC Submission 039325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1258 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32334792-32366014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32343671 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 147 (N147K)
Ref Sequence ENSEMBL: ENSMUSP00000131317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029199] [ENSMUST00000168566]
Predicted Effect probably damaging
Transcript: ENSMUST00000029199
AA Change: N147K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029199
Gene: ENSMUSG00000027663
AA Change: N147K

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168566
AA Change: N147K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131317
Gene: ENSMUSG00000027663
AA Change: N147K

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,937,447 E112G probably damaging Het
Ccar2 T C 14: 70,152,673 N17D probably benign Het
Dnajc9 G A 14: 20,388,697 probably null Het
Igsf9 G A 1: 172,492,155 R339H probably benign Het
Inpp5a G T 7: 139,525,744 G212C probably damaging Het
Itsn2 A G 12: 4,673,464 E1133G probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Pcdhb17 A T 18: 37,485,534 I126L probably damaging Het
Ppil2 A T 16: 17,106,053 L44H probably damaging Het
Qtrt2 A G 16: 43,869,083 V184A possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Sall3 G A 18: 80,974,065 A216V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
St8sia6 T C 2: 13,656,884 M379V probably benign Het
Ubr4 T A 4: 139,426,914 L2144H probably damaging Het
Ythdf1 C A 2: 180,911,310 A371S probably benign Het
Zdhhc16 G A 19: 41,938,044 V89M possibly damaging Het
Zfp37 A T 4: 62,191,817 Y375N probably damaging Het
Other mutations in Zmat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Zmat3 APN 3 32341678 missense possibly damaging 0.82
IGL01687:Zmat3 APN 3 32341531 missense probably damaging 1.00
IGL02251:Zmat3 APN 3 32345583 splice site probably benign
IGL03110:Zmat3 APN 3 32345552 missense probably damaging 0.98
R0585:Zmat3 UTSW 3 32361105 missense probably damaging 0.96
R1916:Zmat3 UTSW 3 32343348 missense probably benign 0.00
R1968:Zmat3 UTSW 3 32360982 missense probably damaging 1.00
R4805:Zmat3 UTSW 3 32343355 missense probably benign 0.00
R4906:Zmat3 UTSW 3 32343687 missense probably damaging 1.00
R6252:Zmat3 UTSW 3 32341621 missense possibly damaging 0.55
R6844:Zmat3 UTSW 3 32341495 missense probably damaging 1.00
R7998:Zmat3 UTSW 3 32341666 missense possibly damaging 0.89
R8316:Zmat3 UTSW 3 32341521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCTCAGAGGCAATGGCAATAC -3'
(R):5'- ACACAGTGGTGCTCAGTAAGGTAGG -3'

Sequencing Primer
(F):5'- TACCTACGAGAATGAGTGACTCTG -3'
(R):5'- ACACAGTAGGTGCTCATTGC -3'
Posted On2014-01-29