Incidental Mutation 'R1258:Inpp5a'
ID151520
Institutional Source Beutler Lab
Gene Symbol Inpp5a
Ensembl Gene ENSMUSG00000025477
Gene Nameinositol polyphosphate-5-phosphatase A
Synonyms
MMRRC Submission 039325-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1258 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139389109-139579652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139525744 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 212 (G212C)
Ref Sequence ENSEMBL: ENSMUSP00000095589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026550] [ENSMUST00000097975] [ENSMUST00000106098]
Predicted Effect probably damaging
Transcript: ENSMUST00000026550
AA Change: G204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026550
Gene: ENSMUSG00000025477
AA Change: G204C

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
low complexity region 415 422 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097975
AA Change: G212C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095589
Gene: ENSMUSG00000025477
AA Change: G212C

DomainStartEndE-ValueType
IPPc 25 408 1.84e-150 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106098
AA Change: G204C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101704
Gene: ENSMUSG00000025477
AA Change: G204C

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152475
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-associated type I inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a gene trapped allele show preweaning lethality, while surviving mice exhibit decreased body size, small cerebellum, and early-onset, slowly progressive Purkinje cell degeneration, gliosis, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,937,447 E112G probably damaging Het
Ccar2 T C 14: 70,152,673 N17D probably benign Het
Dnajc9 G A 14: 20,388,697 probably null Het
Igsf9 G A 1: 172,492,155 R339H probably benign Het
Itsn2 A G 12: 4,673,464 E1133G probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Pcdhb17 A T 18: 37,485,534 I126L probably damaging Het
Ppil2 A T 16: 17,106,053 L44H probably damaging Het
Qtrt2 A G 16: 43,869,083 V184A possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Sall3 G A 18: 80,974,065 A216V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
St8sia6 T C 2: 13,656,884 M379V probably benign Het
Ubr4 T A 4: 139,426,914 L2144H probably damaging Het
Ythdf1 C A 2: 180,911,310 A371S probably benign Het
Zdhhc16 G A 19: 41,938,044 V89M possibly damaging Het
Zfp37 A T 4: 62,191,817 Y375N probably damaging Het
Zmat3 A T 3: 32,343,671 N147K probably damaging Het
Other mutations in Inpp5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Inpp5a APN 7 139516721 missense probably benign 0.00
IGL01354:Inpp5a APN 7 139538234 missense probably damaging 0.99
IGL01734:Inpp5a APN 7 139454090 missense possibly damaging 0.92
IGL02536:Inpp5a APN 7 139567422 missense probably benign 0.17
IGL03023:Inpp5a APN 7 139525786 splice site probably null
IGL03390:Inpp5a APN 7 139525748 missense probably benign 0.01
Anza UTSW 7 139525738 missense probably damaging 1.00
borrego UTSW 7 139525670 missense probably damaging 1.00
Joshua_tree UTSW 7 139574982 missense probably damaging 1.00
PIT4402001:Inpp5a UTSW 7 139511453 missense probably benign 0.02
R0724:Inpp5a UTSW 7 139516663 missense probably benign 0.08
R0940:Inpp5a UTSW 7 139525738 missense probably damaging 1.00
R2112:Inpp5a UTSW 7 139574961 missense probably damaging 0.99
R2328:Inpp5a UTSW 7 139478094 nonsense probably null
R4223:Inpp5a UTSW 7 139558905 missense possibly damaging 0.72
R4307:Inpp5a UTSW 7 139574963 missense possibly damaging 0.87
R4703:Inpp5a UTSW 7 139558923 missense probably damaging 1.00
R4781:Inpp5a UTSW 7 139478005 missense probably benign 0.11
R4997:Inpp5a UTSW 7 139400738 missense probably benign 0.07
R5762:Inpp5a UTSW 7 139538181 missense possibly damaging 0.95
R6014:Inpp5a UTSW 7 139574982 missense probably damaging 1.00
R6381:Inpp5a UTSW 7 139400673 missense probably benign 0.00
R7255:Inpp5a UTSW 7 139511448 missense probably damaging 0.96
R7324:Inpp5a UTSW 7 139525670 missense probably damaging 1.00
R7362:Inpp5a UTSW 7 139578380 missense probably benign 0.00
R7561:Inpp5a UTSW 7 139567422 missense probably damaging 0.99
R7748:Inpp5a UTSW 7 139574995 missense probably damaging 0.96
R8178:Inpp5a UTSW 7 139538237 missense probably damaging 1.00
R8253:Inpp5a UTSW 7 139481640 missense probably damaging 0.99
R8839:Inpp5a UTSW 7 139389433 missense probably benign 0.07
Z1177:Inpp5a UTSW 7 139525775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGGCAATGCTGTAGTTCACTCTG -3'
(R):5'- TGCCATCTGTCAATGTGCAGCTC -3'

Sequencing Primer
(F):5'- GTGCTCAGGACTTTGATGCTAAAC -3'
(R):5'- GCATGAGACCTTCAGGTATAGCTC -3'
Posted On2014-01-29