Incidental Mutation 'R1258:Qtrt2'
ID 151526
Institutional Source Beutler Lab
Gene Symbol Qtrt2
Ensembl Gene ENSMUSG00000022704
Gene Name queuine tRNA-ribosyltransferase accessory subunit 2
Synonyms 3110012M05Rik, Qtrtd1, 4930470H18Rik, Qrtr2
MMRRC Submission 039325-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R1258 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 43681879-43710063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43689446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 184 (V184A)
Ref Sequence ENSEMBL: ENSMUSP00000023387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023387]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000023387
AA Change: V184A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023387
Gene: ENSMUSG00000022704
AA Change: V184A

DomainStartEndE-ValueType
Pfam:TGT 95 340 7.1e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156568
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,539,176 (GRCm39) E112G probably damaging Het
Ccar2 T C 14: 70,390,122 (GRCm39) N17D probably benign Het
Dnajc9 G A 14: 20,438,765 (GRCm39) probably null Het
Igsf9 G A 1: 172,319,722 (GRCm39) R339H probably benign Het
Inpp5a G T 7: 139,105,660 (GRCm39) G212C probably damaging Het
Itsn2 A G 12: 4,723,464 (GRCm39) E1133G probably damaging Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Pcdhb17 A T 18: 37,618,587 (GRCm39) I126L probably damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Sall3 G A 18: 81,017,280 (GRCm39) A216V probably damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
St8sia6 T C 2: 13,661,695 (GRCm39) M379V probably benign Het
Ubr4 T A 4: 139,154,225 (GRCm39) L2144H probably damaging Het
Ypel1 A T 16: 16,923,917 (GRCm39) L44H probably damaging Het
Ythdf1 C A 2: 180,553,103 (GRCm39) A371S probably benign Het
Zdhhc16 G A 19: 41,926,483 (GRCm39) V89M possibly damaging Het
Zfp37 A T 4: 62,110,054 (GRCm39) Y375N probably damaging Het
Zmat3 A T 3: 32,397,820 (GRCm39) N147K probably damaging Het
Other mutations in Qtrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Qtrt2 APN 16 43,701,552 (GRCm39) missense probably damaging 0.99
R1018:Qtrt2 UTSW 16 43,698,363 (GRCm39) missense possibly damaging 0.93
R1499:Qtrt2 UTSW 16 43,689,337 (GRCm39) missense probably benign 0.43
R1574:Qtrt2 UTSW 16 43,692,195 (GRCm39) unclassified probably benign
R1830:Qtrt2 UTSW 16 43,692,018 (GRCm39) missense probably damaging 1.00
R2013:Qtrt2 UTSW 16 43,689,455 (GRCm39) missense probably damaging 1.00
R3835:Qtrt2 UTSW 16 43,701,435 (GRCm39) missense probably damaging 1.00
R5199:Qtrt2 UTSW 16 43,687,788 (GRCm39) missense probably benign 0.10
R7449:Qtrt2 UTSW 16 43,701,395 (GRCm39) missense probably benign 0.06
R7621:Qtrt2 UTSW 16 43,689,303 (GRCm39) splice site probably null
R8143:Qtrt2 UTSW 16 43,692,117 (GRCm39) missense probably damaging 1.00
R8530:Qtrt2 UTSW 16 43,689,407 (GRCm39) missense probably damaging 1.00
R8879:Qtrt2 UTSW 16 43,683,560 (GRCm39) missense probably damaging 1.00
R9629:Qtrt2 UTSW 16 43,683,540 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAGTTCCTTGCTCTAGGTGCCAAC -3'
(R):5'- TCACACTGTGGCCTATGCTTGC -3'

Sequencing Primer
(F):5'- CTGTCTCATGACTTAGGGAAAAC -3'
(R):5'- GCCTATGCTTGCTACCCTGAG -3'
Posted On 2014-01-29