Incidental Mutation 'R1259:Pik3cd'
ID151535
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms2410099E07Rik, p110delta, 2610208K16Rik
MMRRC Submission 039326-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1259 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149649168-149702571 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 149650648 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1046 (R1046*)
Ref Sequence ENSEMBL: ENSMUSP00000136045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000039144] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000105691] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000177654]
Predicted Effect probably null
Transcript: ENSMUST00000038859
AA Change: R1044*
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: R1044*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039144
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105688
AA Change: R1043*
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: R1043*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105689
AA Change: R1042*
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: R1042*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105690
AA Change: R1046*
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: R1046*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105691
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118704
AA Change: R1045*
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: R1045*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122059
AA Change: R1039*
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: R1039*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177654
AA Change: R1046*
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: R1046*

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185093
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik A G 11: 58,447,470 I32T probably benign Het
Adam26a T A 8: 43,568,647 D602V probably benign Het
Adam26a T C 8: 43,568,713 D580G possibly damaging Het
B4galt6 T G 18: 20,706,502 E125A possibly damaging Het
Dnm1l A G 16: 16,324,006 I292T possibly damaging Het
Elp3 A T 14: 65,547,939 I471K probably damaging Het
Fbxw13 A T 9: 109,185,371 V83E probably damaging Het
Gm5422 T C 10: 31,249,115 noncoding transcript Het
Krtap6-5 C T 16: 89,047,719 R42H unknown Het
Lpcat2b C T 5: 107,433,897 A364V probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Muc6 T A 7: 141,640,197 probably benign Het
Olfr1008 T A 2: 85,689,531 I34N probably damaging Het
Olfr901 T A 9: 38,430,873 L197Q probably damaging Het
Pbrm1 T C 14: 31,074,814 F871L probably damaging Het
Pgbd5 T A 8: 124,370,585 D493V probably damaging Het
Pom121l2 G A 13: 21,982,127 W189* probably null Het
Prex2 C A 1: 11,289,270 N1567K probably damaging Het
Prl A G 13: 27,061,489 probably null Het
Ptpro T C 6: 137,392,741 V517A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Vmn2r12 T A 5: 109,091,897 I267F probably damaging Het
Wasf3 T C 5: 146,451,976 V80A probably damaging Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149654571 missense probably benign
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
stinger UTSW 4 149657319 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1246:Pik3cd UTSW 4 149659800 missense probably damaging 1.00
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.02
R1796:Pik3cd UTSW 4 149654119 missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149663203 missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
R6282:Pik3cd UTSW 4 149659743 missense probably benign 0.00
R6453:Pik3cd UTSW 4 149652302 missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149659714 missense probably benign 0.08
R7423:Pik3cd UTSW 4 149651763 critical splice donor site probably null
R7508:Pik3cd UTSW 4 149654583 missense possibly damaging 0.78
R7665:Pik3cd UTSW 4 149654050 missense possibly damaging 0.70
R7897:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R7980:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R8039:Pik3cd UTSW 4 149659866 missense possibly damaging 0.91
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149654847 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCAGTGGTGTGGTTCTTCCC -3'
(R):5'- TCCCCTGAAGGTCACATGACACTC -3'

Sequencing Primer
(F):5'- TTCTTCCCCATGAGGGACAG -3'
(R):5'- CTCTGACATTTGAGTCAACGG -3'
Posted On2014-01-29