Mutagenetix > Incidental Mutation

Incidental Mutation 'R1259:Vmn2r12'

151539

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r12

Ensembl Gene

ENSMUSG00000090688

Gene Name

vomeronasal 2, receptor 12

Synonyms

Gm6769

MMRRC Submission

039326-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R1259 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109085849-109097864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109091897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 267 (I267F)

Ref Sequence

ENSEMBL: ENSMUSP00000093612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095922]

AlphaFold

L7N217

Predicted Effect

probably damaging
Transcript: ENSMUST00000095922
AA Change: I267F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: I267F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.8e-30	PFAM
Pfam:NCD3G	505	559	1.7e-18	PFAM
Pfam:7tm_3	591	827	3.9e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930504O13Rik	A	G	11: 58,447,470	I32T	probably benign	Het
Adam26a	T	A	8: 43,568,647	D602V	probably benign	Het
Adam26a	T	C	8: 43,568,713	D580G	possibly damaging	Het
B4galt6	T	G	18: 20,706,502	E125A	possibly damaging	Het
Dnm1l	A	G	16: 16,324,006	I292T	possibly damaging	Het
Elp3	A	T	14: 65,547,939	I471K	probably damaging	Het
Fbxw13	A	T	9: 109,185,371	V83E	probably damaging	Het
Gm5422	T	C	10: 31,249,115		noncoding transcript	Het
Krtap6-5	C	T	16: 89,047,719	R42H	unknown	Het
Lpcat2b	C	T	5: 107,433,897	A364V	probably damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Med7	C	G	11: 46,440,633	I18M	probably damaging	Het
Muc6	T	A	7: 141,640,197		probably benign	Het
Olfr1008	T	A	2: 85,689,531	I34N	probably damaging	Het
Olfr901	T	A	9: 38,430,873	L197Q	probably damaging	Het
Pbrm1	T	C	14: 31,074,814	F871L	probably damaging	Het
Pgbd5	T	A	8: 124,370,585	D493V	probably damaging	Het
Pik3cd	G	A	4: 149,650,648	R1046*	probably null	Het
Pom121l2	G	A	13: 21,982,127	W189*	probably null	Het
Prex2	C	A	1: 11,289,270	N1567K	probably damaging	Het
Prl	A	G	13: 27,061,489		probably null	Het
Ptpro	T	C	6: 137,392,741	V517A	probably damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Wasf3	T	C	5: 146,451,976	V80A	probably damaging	Het

Other mutations in Vmn2r12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Vmn2r12	APN	5	109097675	missense	possibly damaging	0.47
IGL01096:Vmn2r12	APN	5	109086259	missense	probably damaging	1.00
IGL01538:Vmn2r12	APN	5	109091850	missense	probably damaging	1.00
IGL01548:Vmn2r12	APN	5	109093027	nonsense	probably null
IGL01762:Vmn2r12	APN	5	109086564	missense	probably damaging	0.99
IGL01860:Vmn2r12	APN	5	109092159	missense	probably benign	0.10
IGL02269:Vmn2r12	APN	5	109086477	missense	probably damaging	1.00
IGL02530:Vmn2r12	APN	5	109085992	missense	probably damaging	1.00
IGL02887:Vmn2r12	APN	5	109090485	missense	probably benign	0.03
IGL03265:Vmn2r12	APN	5	109092070	missense	probably benign	0.05
R0396:Vmn2r12	UTSW	5	109092899	missense	probably benign	0.00
R0497:Vmn2r12	UTSW	5	109091889	nonsense	probably null
R0529:Vmn2r12	UTSW	5	109092848	missense	probably benign
R0715:Vmn2r12	UTSW	5	109090507	missense	probably benign	0.10
R0742:Vmn2r12	UTSW	5	109086415	missense	possibly damaging	0.55
R0894:Vmn2r12	UTSW	5	109087850	critical splice donor site	probably null
R1173:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1174:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1349:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R1388:Vmn2r12	UTSW	5	109092974	missense	possibly damaging	0.56
R1549:Vmn2r12	UTSW	5	109092830	missense	probably benign	0.06
R1766:Vmn2r12	UTSW	5	109092044	missense	probably damaging	1.00
R1781:Vmn2r12	UTSW	5	109091728	missense	probably benign	0.00
R1885:Vmn2r12	UTSW	5	109092076	missense	probably damaging	1.00
R2159:Vmn2r12	UTSW	5	109091474	missense	probably benign	0.02
R2420:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2421:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2422:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2937:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R2938:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R3898:Vmn2r12	UTSW	5	109090504	missense	probably benign	0.02
R4061:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4063:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4090:Vmn2r12	UTSW	5	109091546	missense	probably benign	0.06
R4297:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4298:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4299:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4304:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4306:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4307:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4308:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4594:Vmn2r12	UTSW	5	109086435	missense	probably damaging	1.00
R4783:Vmn2r12	UTSW	5	109086513	missense	probably damaging	1.00
R4900:Vmn2r12	UTSW	5	109092986	missense	probably damaging	1.00
R4929:Vmn2r12	UTSW	5	109091678	missense	probably damaging	1.00
R4974:Vmn2r12	UTSW	5	109091506	missense	probably damaging	1.00
R5389:Vmn2r12	UTSW	5	109090395	missense	probably benign	0.00
R5431:Vmn2r12	UTSW	5	109091818	missense	probably damaging	0.99
R5527:Vmn2r12	UTSW	5	109086617	nonsense	probably null
R5639:Vmn2r12	UTSW	5	109092800	missense	probably benign	0.06
R5753:Vmn2r12	UTSW	5	109091804	missense	probably damaging	1.00
R5797:Vmn2r12	UTSW	5	109085870	nonsense	probably null
R6142:Vmn2r12	UTSW	5	109092897	missense	probably benign
R6162:Vmn2r12	UTSW	5	109086564	missense	probably damaging	0.99
R6176:Vmn2r12	UTSW	5	109086000	missense	probably benign	0.43
R6853:Vmn2r12	UTSW	5	109092905	missense	probably damaging	1.00
R7238:Vmn2r12	UTSW	5	109097789	missense	possibly damaging	0.81
R7341:Vmn2r12	UTSW	5	109086247	missense	possibly damaging	0.74
R7341:Vmn2r12	UTSW	5	109091945	missense	possibly damaging	0.95
R7383:Vmn2r12	UTSW	5	109092818	missense	probably benign	0.19
R7740:Vmn2r12	UTSW	5	109091749	missense	probably damaging	1.00
R7749:Vmn2r12	UTSW	5	109086054	missense	probably damaging	0.99
R7861:Vmn2r12	UTSW	5	109087963	missense	probably benign	0.00
R7908:Vmn2r12	UTSW	5	109086441	missense	probably damaging	1.00
R8128:Vmn2r12	UTSW	5	109091881	missense	possibly damaging	0.81
R8175:Vmn2r12	UTSW	5	109090483	missense	probably damaging	0.97
R8234:Vmn2r12	UTSW	5	109086208	missense	probably benign	0.01
R8771:Vmn2r12	UTSW	5	109092086	missense	possibly damaging	0.95
R8947:Vmn2r12	UTSW	5	109086656	missense	possibly damaging	0.64
R8991:Vmn2r12	UTSW	5	109086167	nonsense	probably null
R9116:Vmn2r12	UTSW	5	109086019	missense	probably damaging	1.00
R9122:Vmn2r12	UTSW	5	109093044	missense	probably benign	0.00
R9153:Vmn2r12	UTSW	5	109086337	missense	probably damaging	1.00
R9371:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R9375:Vmn2r12	UTSW	5	109086120	missense	probably damaging	1.00
R9524:Vmn2r12	UTSW	5	109091957	missense	probably damaging	1.00
R9587:Vmn2r12	UTSW	5	109091456	missense	probably damaging	0.99
Z1088:Vmn2r12	UTSW	5	109092780	missense	probably benign
Z1176:Vmn2r12	UTSW	5	109091437	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGTGTGCAAAAGTGACAGTCCC -3'
(R):5'- CAATGTCCATCAGGTAGCCACCAAG -3'

Sequencing Primer
(F):5'- TGACAGTCCCTTGGAAGAAATC -3'
(R):5'- CCTTGATGCTTCATTTTAGATGGAC -3'

Posted On

2014-01-29