Mutagenetix > Incidental Mutation

Incidental Mutation 'R1260:Pdp2'

151575

Institutional Source

Beutler Lab

Gene Symbol

Pdp2

Ensembl Gene

ENSMUSG00000048371

Gene Name

pyruvate dehyrogenase phosphatase catalytic subunit 2

Synonyms

4833426J09Rik, LOC382051

MMRRC Submission

039327-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R1260 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104591451-104599026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104594617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 366 (V366A)

Ref Sequence

ENSEMBL: ENSMUSP00000092821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059588]

AlphaFold

Q504M2

Predicted Effect

probably damaging
Transcript: ENSMUST00000059588
AA Change: V366A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: V366A

Domain	Start	End	E-Value	Type
PP2Cc	96	518	1.1e-92	SMART
PP2C_SIG	121	520	2.56e-1	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Btnl9	T	C	11: 49,169,544	E374G	probably damaging	Het
Car2	G	A	3: 14,895,580	A133T	probably damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cpa6	T	C	1: 10,325,319		probably null	Het
Iqgap3	A	G	3: 88,114,023	H462R	probably benign	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Med7	C	G	11: 46,440,633	I18M	probably damaging	Het
Mertk	A	G	2: 128,762,152	K402R	probably benign	Het
Myh7	T	A	14: 54,988,451	I478F	probably benign	Het
Olfr116	T	A	17: 37,623,703	T311S	probably benign	Het
Plin4	A	T	17: 56,104,348	C894*	probably null	Het
Plxnc1	A	G	10: 94,831,365	V1149A	probably damaging	Het
Rassf9	G	A	10: 102,512,585		probably null	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Stab1	T	C	14: 31,151,889	D984G	probably damaging	Het
Usp45	T	C	4: 21,826,204	S675P	probably damaging	Het

Other mutations in Pdp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Pdp2	APN	8	104594197	missense	probably benign
IGL01771:Pdp2	APN	8	104594122	missense	probably benign	0.06
IGL01946:Pdp2	APN	8	104594192	missense	probably benign	0.00
IGL02313:Pdp2	APN	8	104594899	missense	probably benign	0.44
IGL02588:Pdp2	APN	8	104594904	missense	possibly damaging	0.73
IGL02981:Pdp2	APN	8	104593635	missense	probably benign	0.00
R0456:Pdp2	UTSW	8	104593789	missense	probably damaging	1.00
R1974:Pdp2	UTSW	8	104593906	missense	probably benign
R3008:Pdp2	UTSW	8	104594266	missense	probably benign	0.08
R4580:Pdp2	UTSW	8	104594944	missense	probably damaging	1.00
R4655:Pdp2	UTSW	8	104594536	missense	probably benign	0.03
R5677:Pdp2	UTSW	8	104594688	missense	probably damaging	1.00
R6813:Pdp2	UTSW	8	104594499	missense	probably damaging	1.00
R8176:Pdp2	UTSW	8	104595055	missense	probably damaging	1.00
R8472:Pdp2	UTSW	8	104594281	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGACCACAACGCCTGGAATGAG -3'
(R):5'- TGGCACCAGAGGGAGACTCTTAAC -3'

Sequencing Primer
(F):5'- GAATGAGGCTGAGCTGTCC -3'
(R):5'- TTATGGCGACCCACCTTGG -3'

Posted On

2014-01-29