Incidental Mutation 'R1260:Pdp2'
ID 151575
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Name pyruvate dehydrogenase phosphatase catalytic subunit 2
Synonyms LOC382051, 4833426J09Rik
MMRRC Submission 039327-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R1260 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 105318104-105325658 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105321249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 366 (V366A)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
AlphaFold Q504M2
Predicted Effect probably damaging
Transcript: ENSMUST00000059588
AA Change: V366A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: V366A

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl9 T C 11: 49,060,371 (GRCm39) E374G probably damaging Het
Car2 G A 3: 14,960,640 (GRCm39) A133T probably damaging Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Cpa6 T C 1: 10,395,544 (GRCm39) probably null Het
Iqgap3 A G 3: 88,021,330 (GRCm39) H462R probably benign Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Med7 C G 11: 46,331,460 (GRCm39) I18M probably damaging Het
Mertk A G 2: 128,604,072 (GRCm39) K402R probably benign Het
Myh7 T A 14: 55,225,908 (GRCm39) I478F probably benign Het
Or14j10 T A 17: 37,934,594 (GRCm39) T311S probably benign Het
Plin4 A T 17: 56,411,348 (GRCm39) C894* probably null Het
Plxnc1 A G 10: 94,667,227 (GRCm39) V1149A probably damaging Het
Rassf9 G A 10: 102,348,446 (GRCm39) probably null Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Stab1 T C 14: 30,873,846 (GRCm39) D984G probably damaging Het
Usp45 T C 4: 21,826,204 (GRCm39) S675P probably damaging Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 105,320,829 (GRCm39) missense probably benign
IGL01771:Pdp2 APN 8 105,320,754 (GRCm39) missense probably benign 0.06
IGL01946:Pdp2 APN 8 105,320,824 (GRCm39) missense probably benign 0.00
IGL02313:Pdp2 APN 8 105,321,531 (GRCm39) missense probably benign 0.44
IGL02588:Pdp2 APN 8 105,321,536 (GRCm39) missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 105,320,267 (GRCm39) missense probably benign 0.00
R0456:Pdp2 UTSW 8 105,320,421 (GRCm39) missense probably damaging 1.00
R1974:Pdp2 UTSW 8 105,320,538 (GRCm39) missense probably benign
R3008:Pdp2 UTSW 8 105,320,898 (GRCm39) missense probably benign 0.08
R4580:Pdp2 UTSW 8 105,321,576 (GRCm39) missense probably damaging 1.00
R4655:Pdp2 UTSW 8 105,321,168 (GRCm39) missense probably benign 0.03
R5677:Pdp2 UTSW 8 105,321,320 (GRCm39) missense probably damaging 1.00
R6813:Pdp2 UTSW 8 105,321,131 (GRCm39) missense probably damaging 1.00
R8176:Pdp2 UTSW 8 105,321,687 (GRCm39) missense probably damaging 1.00
R8472:Pdp2 UTSW 8 105,320,913 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCACAACGCCTGGAATGAG -3'
(R):5'- TGGCACCAGAGGGAGACTCTTAAC -3'

Sequencing Primer
(F):5'- GAATGAGGCTGAGCTGTCC -3'
(R):5'- TTATGGCGACCCACCTTGG -3'
Posted On 2014-01-29