Incidental Mutation 'R1260:Pdp2'
ID151575
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 2
Synonyms4833426J09Rik, LOC382051
MMRRC Submission 039327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1260 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104591451-104599026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104594617 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 366 (V366A)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
Predicted Effect probably damaging
Transcript: ENSMUST00000059588
AA Change: V366A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: V366A

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl9 T C 11: 49,169,544 E374G probably damaging Het
Car2 G A 3: 14,895,580 A133T probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cpa6 T C 1: 10,325,319 probably null Het
Iqgap3 A G 3: 88,114,023 H462R probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Mertk A G 2: 128,762,152 K402R probably benign Het
Myh7 T A 14: 54,988,451 I478F probably benign Het
Olfr116 T A 17: 37,623,703 T311S probably benign Het
Plin4 A T 17: 56,104,348 C894* probably null Het
Plxnc1 A G 10: 94,831,365 V1149A probably damaging Het
Rassf9 G A 10: 102,512,585 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Stab1 T C 14: 31,151,889 D984G probably damaging Het
Usp45 T C 4: 21,826,204 S675P probably damaging Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 104594197 missense probably benign
IGL01771:Pdp2 APN 8 104594122 missense probably benign 0.06
IGL01946:Pdp2 APN 8 104594192 missense probably benign 0.00
IGL02313:Pdp2 APN 8 104594899 missense probably benign 0.44
IGL02588:Pdp2 APN 8 104594904 missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 104593635 missense probably benign 0.00
R0456:Pdp2 UTSW 8 104593789 missense probably damaging 1.00
R1974:Pdp2 UTSW 8 104593906 missense probably benign
R3008:Pdp2 UTSW 8 104594266 missense probably benign 0.08
R4580:Pdp2 UTSW 8 104594944 missense probably damaging 1.00
R4655:Pdp2 UTSW 8 104594536 missense probably benign 0.03
R5677:Pdp2 UTSW 8 104594688 missense probably damaging 1.00
R6813:Pdp2 UTSW 8 104594499 missense probably damaging 1.00
R8176:Pdp2 UTSW 8 104595055 missense probably damaging 1.00
R8472:Pdp2 UTSW 8 104594281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCACAACGCCTGGAATGAG -3'
(R):5'- TGGCACCAGAGGGAGACTCTTAAC -3'

Sequencing Primer
(F):5'- GAATGAGGCTGAGCTGTCC -3'
(R):5'- TTATGGCGACCCACCTTGG -3'
Posted On2014-01-29