Incidental Mutation 'R1260:Plxnc1'
ID 151578
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Name plexin C1
Synonyms 2510048K12Rik, vespr, CD232
MMRRC Submission 039327-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R1260 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 94626728-94780697 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94667227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1149 (V1149A)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
AlphaFold Q9QZC2
Predicted Effect probably damaging
Transcript: ENSMUST00000099337
AA Change: V1149A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: V1149A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218839
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl9 T C 11: 49,060,371 (GRCm39) E374G probably damaging Het
Car2 G A 3: 14,960,640 (GRCm39) A133T probably damaging Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Cpa6 T C 1: 10,395,544 (GRCm39) probably null Het
Iqgap3 A G 3: 88,021,330 (GRCm39) H462R probably benign Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Med7 C G 11: 46,331,460 (GRCm39) I18M probably damaging Het
Mertk A G 2: 128,604,072 (GRCm39) K402R probably benign Het
Myh7 T A 14: 55,225,908 (GRCm39) I478F probably benign Het
Or14j10 T A 17: 37,934,594 (GRCm39) T311S probably benign Het
Pdp2 T C 8: 105,321,249 (GRCm39) V366A probably damaging Het
Plin4 A T 17: 56,411,348 (GRCm39) C894* probably null Het
Rassf9 G A 10: 102,348,446 (GRCm39) probably null Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Stab1 T C 14: 30,873,846 (GRCm39) D984G probably damaging Het
Usp45 T C 4: 21,826,204 (GRCm39) S675P probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94,683,411 (GRCm39) missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94,635,230 (GRCm39) missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94,634,008 (GRCm39) missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94,685,801 (GRCm39) missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94,758,587 (GRCm39) missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94,706,893 (GRCm39) missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94,718,453 (GRCm39) missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94,630,542 (GRCm39) splice site probably null
IGL02973:Plxnc1 APN 10 94,646,546 (GRCm39) missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94,635,209 (GRCm39) missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94,648,991 (GRCm39) missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94,673,780 (GRCm39) missense probably null 1.00
R0299:Plxnc1 UTSW 10 94,685,683 (GRCm39) critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94,632,344 (GRCm39) missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94,673,797 (GRCm39) missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94,635,230 (GRCm39) missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94,635,194 (GRCm39) missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94,673,362 (GRCm39) critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94,667,195 (GRCm39) splice site probably benign
R1184:Plxnc1 UTSW 10 94,667,195 (GRCm39) splice site probably benign
R1680:Plxnc1 UTSW 10 94,677,413 (GRCm39) missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94,680,041 (GRCm39) splice site probably null
R1750:Plxnc1 UTSW 10 94,635,359 (GRCm39) missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94,685,677 (GRCm39) unclassified probably benign
R1768:Plxnc1 UTSW 10 94,680,184 (GRCm39) missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94,702,803 (GRCm39) missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94,688,484 (GRCm39) missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94,779,529 (GRCm39) missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94,780,131 (GRCm39) missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94,742,395 (GRCm39) missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94,629,154 (GRCm39) critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94,706,872 (GRCm39) missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94,630,294 (GRCm39) missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94,746,549 (GRCm39) splice site probably null
R4004:Plxnc1 UTSW 10 94,630,459 (GRCm39) nonsense probably null
R4679:Plxnc1 UTSW 10 94,630,306 (GRCm39) missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94,703,330 (GRCm39) intron probably benign
R4937:Plxnc1 UTSW 10 94,677,335 (GRCm39) missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94,635,239 (GRCm39) missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94,685,831 (GRCm39) missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94,679,614 (GRCm39) missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94,673,416 (GRCm39) missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94,758,604 (GRCm39) missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94,700,636 (GRCm39) missense probably benign
R5826:Plxnc1 UTSW 10 94,635,335 (GRCm39) critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94,629,152 (GRCm39) missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94,779,710 (GRCm39) missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94,779,635 (GRCm39) missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94,669,504 (GRCm39) splice site probably null
R6653:Plxnc1 UTSW 10 94,779,738 (GRCm39) missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94,667,392 (GRCm39) missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94,667,297 (GRCm39) missense probably benign
R7401:Plxnc1 UTSW 10 94,706,867 (GRCm39) missense probably benign
R7727:Plxnc1 UTSW 10 94,779,971 (GRCm39) missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94,630,339 (GRCm39) missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94,779,377 (GRCm39) critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94,630,302 (GRCm39) missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94,679,698 (GRCm39) missense probably benign
R8103:Plxnc1 UTSW 10 94,706,944 (GRCm39) missense probably benign
R8226:Plxnc1 UTSW 10 94,669,230 (GRCm39) missense possibly damaging 0.90
R8273:Plxnc1 UTSW 10 94,649,105 (GRCm39) missense probably benign 0.14
R8299:Plxnc1 UTSW 10 94,663,041 (GRCm39) missense probably benign 0.35
R8392:Plxnc1 UTSW 10 94,637,352 (GRCm39) missense possibly damaging 0.75
R8758:Plxnc1 UTSW 10 94,758,607 (GRCm39) missense possibly damaging 0.91
R8806:Plxnc1 UTSW 10 94,635,140 (GRCm39) missense probably damaging 1.00
R8882:Plxnc1 UTSW 10 94,677,428 (GRCm39) missense probably damaging 1.00
R8893:Plxnc1 UTSW 10 94,685,709 (GRCm39) missense probably benign 0.35
R8956:Plxnc1 UTSW 10 94,746,448 (GRCm39) missense probably benign 0.00
R9040:Plxnc1 UTSW 10 94,779,379 (GRCm39) nonsense probably null
R9102:Plxnc1 UTSW 10 94,663,107 (GRCm39) missense probably damaging 1.00
R9225:Plxnc1 UTSW 10 94,629,061 (GRCm39) missense probably damaging 1.00
R9324:Plxnc1 UTSW 10 94,780,685 (GRCm39) start gained probably benign
R9368:Plxnc1 UTSW 10 94,700,599 (GRCm39) nonsense probably null
R9375:Plxnc1 UTSW 10 94,649,093 (GRCm39) missense probably benign 0.20
R9430:Plxnc1 UTSW 10 94,758,544 (GRCm39) missense probably benign 0.01
R9460:Plxnc1 UTSW 10 94,700,895 (GRCm39) missense probably benign
R9498:Plxnc1 UTSW 10 94,649,004 (GRCm39) missense possibly damaging 0.48
RF003:Plxnc1 UTSW 10 94,630,306 (GRCm39) missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94,700,577 (GRCm39) critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94,700,891 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCAGTGTGCCAGTGAGTAATGAG -3'
(R):5'- TCTGCAAACCAAACTGGTCTACCTG -3'

Sequencing Primer
(F):5'- GGACTCAAGAACAGTTTGTGCTC -3'
(R):5'- TACCTGACCAGCATCCTGGAG -3'
Posted On 2014-01-29