Incidental Mutation 'R1260:Rassf9'
ID151579
Institutional Source Beutler Lab
Gene Symbol Rassf9
Ensembl Gene ENSMUSG00000044921
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 9
SynonymsPamci
MMRRC Submission 039327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1260 (G1)
Quality Score85
Status Not validated
Chromosome10
Chromosomal Location102512222-102549736 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 102512585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055355] [ENSMUST00000219445]
Predicted Effect probably null
Transcript: ENSMUST00000055355
SMART Domains Protein: ENSMUSP00000054767
Gene: ENSMUSG00000044921

DomainStartEndE-ValueType
RA 23 119 5.33e-18 SMART
coiled coil region 261 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220230
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to perinuclear endosomes. This protein associates with peptidylglycine alpha-amidating monooxygenase, and may be involved with the trafficking of this enzyme through secretory or endosomal pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature lethality, alopecia, lung defects, and abnormal skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl9 T C 11: 49,169,544 E374G probably damaging Het
Car2 G A 3: 14,895,580 A133T probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cpa6 T C 1: 10,325,319 probably null Het
Iqgap3 A G 3: 88,114,023 H462R probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Mertk A G 2: 128,762,152 K402R probably benign Het
Myh7 T A 14: 54,988,451 I478F probably benign Het
Olfr116 T A 17: 37,623,703 T311S probably benign Het
Pdp2 T C 8: 104,594,617 V366A probably damaging Het
Plin4 A T 17: 56,104,348 C894* probably null Het
Plxnc1 A G 10: 94,831,365 V1149A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Stab1 T C 14: 31,151,889 D984G probably damaging Het
Usp45 T C 4: 21,826,204 S675P probably damaging Het
Other mutations in Rassf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Rassf9 APN 10 102545633 missense probably benign 0.04
IGL02396:Rassf9 APN 10 102545693 missense possibly damaging 0.74
IGL02714:Rassf9 APN 10 102512563 missense possibly damaging 0.85
IGL02987:Rassf9 APN 10 102545248 missense possibly damaging 0.60
IGL03376:Rassf9 APN 10 102545198 missense probably damaging 0.96
R0372:Rassf9 UTSW 10 102546011 missense possibly damaging 0.71
R0377:Rassf9 UTSW 10 102545649 missense probably benign 0.00
R1481:Rassf9 UTSW 10 102546034 missense probably benign 0.01
R1563:Rassf9 UTSW 10 102544960 missense probably damaging 0.97
R1894:Rassf9 UTSW 10 102544894 missense possibly damaging 0.92
R1913:Rassf9 UTSW 10 102544939 missense probably benign 0.04
R2115:Rassf9 UTSW 10 102544945 missense probably benign 0.02
R3149:Rassf9 UTSW 10 102544826 missense possibly damaging 0.85
R5072:Rassf9 UTSW 10 102545905 missense probably damaging 0.98
R5282:Rassf9 UTSW 10 102545344 missense probably damaging 1.00
R5804:Rassf9 UTSW 10 102545044 missense probably damaging 1.00
R6296:Rassf9 UTSW 10 102545753 missense probably damaging 1.00
R6662:Rassf9 UTSW 10 102546038 missense possibly damaging 0.90
R7719:Rassf9 UTSW 10 102545600 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCGCAGTTCAAAGTTAGGCAG -3'
(R):5'- CGGGATACGTCCATCGTCAATACAG -3'

Sequencing Primer
(F):5'- CTGCTAATGAGCTTGAAAGCAAGG -3'
(R):5'- CTCGCCAAACAGTTCTCATC -3'
Posted On2014-01-29