Incidental Mutation 'R1260:Olfr116'
ID151587
Institutional Source Beutler Lab
Gene Symbol Olfr116
Ensembl Gene ENSMUSG00000061336
Gene Nameolfactory receptor 116
SynonymsMOR218-2, GA_x6K02T2PSCP-2084102-2083137
MMRRC Submission 039327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1260 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37620577-37627199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37623703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 311 (T311S)
Ref Sequence ENSEMBL: ENSMUSP00000150977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072265] [ENSMUST00000216128] [ENSMUST00000223366]
Predicted Effect probably benign
Transcript: ENSMUST00000072265
AA Change: T311S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072115
Gene: ENSMUSG00000061336
AA Change: T311S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 6.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216128
AA Change: T311S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000223366
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl9 T C 11: 49,169,544 E374G probably damaging Het
Car2 G A 3: 14,895,580 A133T probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cpa6 T C 1: 10,325,319 probably null Het
Iqgap3 A G 3: 88,114,023 H462R probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Mertk A G 2: 128,762,152 K402R probably benign Het
Myh7 T A 14: 54,988,451 I478F probably benign Het
Pdp2 T C 8: 104,594,617 V366A probably damaging Het
Plin4 A T 17: 56,104,348 C894* probably null Het
Plxnc1 A G 10: 94,831,365 V1149A probably damaging Het
Rassf9 G A 10: 102,512,585 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Stab1 T C 14: 31,151,889 D984G probably damaging Het
Usp45 T C 4: 21,826,204 S675P probably damaging Het
Other mutations in Olfr116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Olfr116 APN 17 37624576 missense possibly damaging 0.86
IGL02639:Olfr116 APN 17 37623987 missense probably benign 0.01
IGL02663:Olfr116 APN 17 37624044 missense probably benign 0.37
R0049:Olfr116 UTSW 17 37624133 missense probably benign 0.02
R1531:Olfr116 UTSW 17 37624352 nonsense probably null
R3236:Olfr116 UTSW 17 37624236 missense possibly damaging 0.65
R4083:Olfr116 UTSW 17 37624425 missense probably damaging 1.00
R4308:Olfr116 UTSW 17 37623736 missense possibly damaging 0.46
R4887:Olfr116 UTSW 17 37623891 missense probably damaging 0.99
R5167:Olfr116 UTSW 17 37623751 nonsense probably null
R5323:Olfr116 UTSW 17 37624155 missense probably benign 0.22
R5496:Olfr116 UTSW 17 37624578 missense probably benign 0.01
R5530:Olfr116 UTSW 17 37623807 missense possibly damaging 0.72
R5643:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5644:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5798:Olfr116 UTSW 17 37623990 missense probably benign 0.01
R6020:Olfr116 UTSW 17 37623967 missense possibly damaging 0.94
R7058:Olfr116 UTSW 17 37623706 missense probably benign 0.00
R7453:Olfr116 UTSW 17 37624385 missense probably benign 0.00
R7474:Olfr116 UTSW 17 37624386 missense probably benign 0.30
R7565:Olfr116 UTSW 17 37624501 missense probably damaging 0.99
R7646:Olfr116 UTSW 17 37624404 missense probably damaging 1.00
Z1088:Olfr116 UTSW 17 37624429 missense probably damaging 0.98
Z1187:Olfr116 UTSW 17 37623844 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ggtggaatgctccaggcaTACTTTGAT -3'
(R):5'- ACACAAGCTCAGACTCTCCAACTGCTTT -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtgtgtCTTTCTG -3'
(R):5'- TTACACAGTACTACCTCCAACTC -3'
Posted On2014-01-29