Incidental Mutation 'R1261:Olfr1002'
ID151590
Institutional Source Beutler Lab
Gene Symbol Olfr1002
Ensembl Gene ENSMUSG00000075214
Gene Nameolfactory receptor 1002
SynonymsGA_x6K02T2Q125-47127746-47126790, MOR175-2
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85646057-85650704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85647799 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 174 (I174S)
Ref Sequence ENSEMBL: ENSMUSP00000150405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099920] [ENSMUST00000215548]
Predicted Effect probably damaging
Transcript: ENSMUST00000099920
AA Change: I174S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097504
Gene: ENSMUSG00000075214
AA Change: I174S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-50 PFAM
Pfam:7tm_1 41 290 2.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215548
AA Change: I174S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Olfr1002
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Olfr1002 APN 2 85648143 missense probably damaging 0.98
IGL02873:Olfr1002 APN 2 85647752 missense possibly damaging 0.50
PIT4362001:Olfr1002 UTSW 2 85647724 missense probably damaging 1.00
R1241:Olfr1002 UTSW 2 85647560 missense probably damaging 1.00
R1666:Olfr1002 UTSW 2 85647813 nonsense probably null
R1902:Olfr1002 UTSW 2 85647857 missense possibly damaging 0.81
R1965:Olfr1002 UTSW 2 85647746 missense possibly damaging 0.94
R2096:Olfr1002 UTSW 2 85648090 missense probably benign 0.20
R4239:Olfr1002 UTSW 2 85648303 missense probably damaging 0.98
R4730:Olfr1002 UTSW 2 85647992 missense probably benign 0.39
R4948:Olfr1002 UTSW 2 85647572 missense probably benign 0.30
R5627:Olfr1002 UTSW 2 85647647 missense probably damaging 1.00
R5844:Olfr1002 UTSW 2 85647895 missense probably benign 0.36
R6809:Olfr1002 UTSW 2 85647973 missense probably damaging 1.00
R7399:Olfr1002 UTSW 2 85647424 missense possibly damaging 0.89
R7476:Olfr1002 UTSW 2 85648168 missense not run
R7805:Olfr1002 UTSW 2 85647450 nonsense probably null
R7960:Olfr1002 UTSW 2 85648073 missense possibly damaging 0.82
R8015:Olfr1002 UTSW 2 85647792 missense probably damaging 0.99
R8355:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCGCCTCCCATCAGCAGAATTG -3'
(R):5'- AGCCACTTGTCCTTTGTGGATGCC -3'

Sequencing Primer
(F):5'- CCCATCAGCAGAATTGATCTTTAGG -3'
(R):5'- AGTGACAGAATGTTTCCTCCTG -3'
Posted On2014-01-29