Mutagenetix > Incidental Mutations

Incidental Mutation 'R1261:Myh7b'

151591

Institutional Source

Beutler Lab

Gene Symbol

Myh7b

Ensembl Gene

ENSMUSG00000074652

Gene Name

myosin, heavy chain 7B, cardiac muscle, beta

Synonyms

Myh14

MMRRC Submission

039328-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1261 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

155611212-155634307 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155621083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 453 (K453R)

Ref Sequence

ENSEMBL: ENSMUSP00000090672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092995]

AlphaFold

A2AQP0

Predicted Effect

probably benign
Transcript: ENSMUST00000092995
AA Change: K453R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: K453R

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	32	72	4.7e-14	PFAM
MYSc	78	786	N/A	SMART
IQ	787	809	2.6e0	SMART
Pfam:Myosin_tail_1	850	1931	5.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000102357

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,935,488	V114A	probably benign	Het
Arhgef38	T	C	3: 133,160,863	E171G	possibly damaging	Het
Arsi	A	G	18: 60,916,671	T209A	probably damaging	Het
BC005561	A	G	5: 104,520,635	T1008A	probably damaging	Het
Bmp3	A	T	5: 98,879,926	R468S	probably damaging	Het
Cenpk	T	A	13: 104,230,785	V43E	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cul9	G	T	17: 46,525,782	L1106M	probably damaging	Het
Dnajc9	G	A	14: 20,388,697		probably null	Het
Enpp3	A	T	10: 24,774,934	V768E	probably damaging	Het
Klk5	T	C	7: 43,845,290	S66P	probably damaging	Het
Lrriq1	T	C	10: 103,234,137	D6G	possibly damaging	Het
Nipsnap3b	G	T	4: 53,015,166	G71V	probably damaging	Het
Oas1h	A	G	5: 120,871,867	E335G	probably benign	Het
Olfr1002	A	C	2: 85,647,799	I174S	probably damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Slc10a1	T	A	12: 80,967,830	M39L	probably damaging	Het
Tas1r2	G	A	4: 139,655,288	R79Q	probably damaging	Het
Tmprss11d	T	C	5: 86,309,380	D140G	possibly damaging	Het

Other mutations in Myh7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Myh7b	APN	2	155630292	missense	probably damaging	0.99
IGL01604:Myh7b	APN	2	155632407	missense	probably damaging	0.96
IGL02179:Myh7b	APN	2	155614491	missense	probably benign	0.02
IGL02729:Myh7b	APN	2	155625689	missense	probably damaging	1.00
IGL02804:Myh7b	APN	2	155625723	missense	probably damaging	1.00
IGL02851:Myh7b	APN	2	155628827	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155632903	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155625954	missense	possibly damaging	0.95
IGL02992:Myh7b	APN	2	155621410	missense	probably damaging	0.99
IGL03060:Myh7b	APN	2	155632751	missense	probably damaging	1.00
IGL03061:Myh7b	APN	2	155620111	missense	possibly damaging	0.93
IGL03226:Myh7b	APN	2	155620483	nonsense	probably null
IGL03246:Myh7b	APN	2	155617872	missense	probably damaging	1.00
IGL03382:Myh7b	APN	2	155623479	missense	probably damaging	1.00
euclidian	UTSW	2	155633399	missense	probably benign	0.32
imaginary	UTSW	2	155632255	missense	probably benign	0.36
Irrational	UTSW	2	155630672	unclassified	probably benign
Muscoli	UTSW	2	155620118	nonsense	probably null
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0109:Myh7b	UTSW	2	155611674	missense	possibly damaging	0.92
R0309:Myh7b	UTSW	2	155630672	unclassified	probably benign
R0567:Myh7b	UTSW	2	155626398	missense	probably damaging	1.00
R0619:Myh7b	UTSW	2	155611722	missense	probably benign	0.00
R0927:Myh7b	UTSW	2	155620120	missense	probably damaging	1.00
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0974:Myh7b	UTSW	2	155620427	missense	probably benign
R1137:Myh7b	UTSW	2	155622714	missense	probably damaging	1.00
R1268:Myh7b	UTSW	2	155614046	nonsense	probably null
R1537:Myh7b	UTSW	2	155631787	missense	probably damaging	0.96
R1632:Myh7b	UTSW	2	155620525	missense	probably benign	0.04
R1694:Myh7b	UTSW	2	155613193	missense	probably damaging	0.99
R1697:Myh7b	UTSW	2	155620134	missense	probably damaging	1.00
R1730:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R1762:Myh7b	UTSW	2	155630858	missense	probably damaging	0.96
R1783:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R2105:Myh7b	UTSW	2	155629457	missense	probably benign	0.00
R2140:Myh7b	UTSW	2	155620123	missense	probably damaging	1.00
R2971:Myh7b	UTSW	2	155632255	missense	probably benign	0.36
R3838:Myh7b	UTSW	2	155632989	missense	probably damaging	1.00
R4074:Myh7b	UTSW	2	155618758	missense	probably damaging	0.96
R4191:Myh7b	UTSW	2	155633399	missense	probably benign	0.32
R4689:Myh7b	UTSW	2	155630514	missense	possibly damaging	0.75
R4695:Myh7b	UTSW	2	155614177	missense	probably damaging	1.00
R4697:Myh7b	UTSW	2	155629322	missense	probably damaging	1.00
R4771:Myh7b	UTSW	2	155626394	nonsense	probably null
R4794:Myh7b	UTSW	2	155623266	missense	probably benign	0.00
R4842:Myh7b	UTSW	2	155633989	missense	probably benign	0.45
R4871:Myh7b	UTSW	2	155613500	missense	probably benign	0.18
R5022:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5023:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5025:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5050:Myh7b	UTSW	2	155631750	missense	probably benign	0.00
R5055:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5056:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5161:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5284:Myh7b	UTSW	2	155632314	missense	probably benign
R5422:Myh7b	UTSW	2	155631034	missense	probably damaging	0.99
R5505:Myh7b	UTSW	2	155632672	missense	probably benign	0.01
R5946:Myh7b	UTSW	2	155621395	missense	probably damaging	1.00
R6089:Myh7b	UTSW	2	155622489	missense	probably damaging	1.00
R6103:Myh7b	UTSW	2	155618743	missense	probably damaging	1.00
R6233:Myh7b	UTSW	2	155631799	missense	possibly damaging	0.85
R6292:Myh7b	UTSW	2	155632396	missense	probably damaging	1.00
R6350:Myh7b	UTSW	2	155628760	missense	probably benign	0.00
R6484:Myh7b	UTSW	2	155628643	missense	probably benign	0.05
R6760:Myh7b	UTSW	2	155620118	nonsense	probably null
R6896:Myh7b	UTSW	2	155622568	critical splice donor site	probably null
R6945:Myh7b	UTSW	2	155622232	missense	possibly damaging	0.95
R7020:Myh7b	UTSW	2	155631751	missense	possibly damaging	0.56
R7052:Myh7b	UTSW	2	155614133	missense	probably damaging	1.00
R7102:Myh7b	UTSW	2	155622199	missense	probably damaging	1.00
R7248:Myh7b	UTSW	2	155622186	missense	probably damaging	1.00
R7303:Myh7b	UTSW	2	155618740	missense	probably damaging	1.00
R7360:Myh7b	UTSW	2	155632540	missense	probably benign	0.38
R7652:Myh7b	UTSW	2	155632236	missense	probably damaging	0.99
R7678:Myh7b	UTSW	2	155617778	splice site	probably null
R7703:Myh7b	UTSW	2	155620436	missense	probably null	1.00
R7711:Myh7b	UTSW	2	155620403	missense	probably damaging	1.00
R7923:Myh7b	UTSW	2	155625966	missense	probably benign
R7967:Myh7b	UTSW	2	155614199	splice site	probably null
R8045:Myh7b	UTSW	2	155613181	missense	probably benign	0.00
R8176:Myh7b	UTSW	2	155625966	missense	probably benign	0.06
R8272:Myh7b	UTSW	2	155632904	missense	probably damaging	1.00
R8560:Myh7b	UTSW	2	155623204	missense	possibly damaging	0.93
R8706:Myh7b	UTSW	2	155611749	critical splice donor site	probably null
R8824:Myh7b	UTSW	2	155630381	missense	probably benign	0.02
R8832:Myh7b	UTSW	2	155633262	missense	probably benign	0.00
R9079:Myh7b	UTSW	2	155623254	missense	probably damaging	0.97
R9151:Myh7b	UTSW	2	155632519	missense	probably damaging	1.00
R9311:Myh7b	UTSW	2	155621333	missense	probably damaging	1.00
R9332:Myh7b	UTSW	2	155628802	missense	probably damaging	1.00
R9357:Myh7b	UTSW	2	155621348	missense	probably damaging	1.00
R9388:Myh7b	UTSW	2	155631063	missense	probably benign	0.28
X0013:Myh7b	UTSW	2	155631169	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATGTTACCAAGGGCCAGAGTGTG -3'
(R):5'- GAAGTCGATGAAGACCCAGTCGATG -3'

Sequencing Primer
(F):5'- CCAGAGTGTGGAGCAGGTG -3'
(R):5'- GCTGCTCGAAGCTGTTAAAC -3'

Posted On

2014-01-29