Incidental Mutation 'R1261:Arhgef38'
ID151592
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene NameRho guanine nucleotide exchange factor (GEF) 38
SynonymsD630013G24Rik, 9130221D24Rik
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location133112278-133234949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133160863 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 171 (E171G)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147041] [ENSMUST00000161022]
Predicted Effect possibly damaging
Transcript: ENSMUST00000147041
AA Change: E171G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: E171G

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161022
AA Change: E171G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124280
Gene: ENSMUSG00000040969
AA Change: E171G

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
Pfam:RhoGEF 98 219 2e-24 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 splice site probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
R8050:Arhgef38 UTSW 3 133137562 nonsense probably null
Z1177:Arhgef38 UTSW 3 133206961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCGCCTTCCGAGAAAGACCTTAC -3'
(R):5'- TGATTCTGTGTGCCAACCCATTAGC -3'

Sequencing Primer
(F):5'- ACGCTGTGTGCTTCATCA -3'
(R):5'- agaaaagaagagaggaaaagggag -3'
Posted On2014-01-29