Incidental Mutation 'R1261:Nipsnap3b'
ID151593
Institutional Source Beutler Lab
Gene Symbol Nipsnap3b
Ensembl Gene ENSMUSG00000015247
Gene Namenipsnap homolog 3B
Synonyms
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53011880-53022060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53015166 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 71 (G71V)
Ref Sequence ENSEMBL: ENSMUSP00000103292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015391] [ENSMUST00000107665]
Predicted Effect probably damaging
Transcript: ENSMUST00000015391
AA Change: G71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015391
Gene: ENSMUSG00000015247
AA Change: G71V

DomainStartEndE-ValueType
Pfam:NIPSNAP 37 136 1.5e-32 PFAM
Pfam:NIPSNAP 146 245 5.5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107665
AA Change: G71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103292
Gene: ENSMUSG00000015247
AA Change: G71V

DomainStartEndE-ValueType
Pfam:NIPSNAP 37 136 2.2e-30 PFAM
Pfam:NIPSNAP 134 195 8.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NIPSNAP3A belongs to a family of proteins with putative roles in vesicular transport (Buechler et al., 2004 [PubMed 15177564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Nipsnap3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Nipsnap3b APN 4 53015016 missense possibly damaging 0.80
R0008:Nipsnap3b UTSW 4 53015112 missense probably damaging 1.00
R0008:Nipsnap3b UTSW 4 53015112 missense probably damaging 1.00
R0148:Nipsnap3b UTSW 4 53017088 missense possibly damaging 0.56
R0518:Nipsnap3b UTSW 4 53021343 missense probably damaging 0.99
R1262:Nipsnap3b UTSW 4 53015166 missense probably damaging 1.00
R1954:Nipsnap3b UTSW 4 53017213 splice site probably benign
R5861:Nipsnap3b UTSW 4 53021177 missense probably damaging 1.00
R6213:Nipsnap3b UTSW 4 53017066 missense probably benign 0.01
R6950:Nipsnap3b UTSW 4 53015136 missense possibly damaging 0.90
R7076:Nipsnap3b UTSW 4 53021095 splice site probably null
R8397:Nipsnap3b UTSW 4 53012049 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTATGTTCACCTTTTGCTACAGGC -3'
(R):5'- CACGAGGACATTCTCAATTCCTCTGC -3'

Sequencing Primer
(F):5'- TTTTGCTACAGGCCCCAGG -3'
(R):5'- AAGCTGATGGTCAGATATCCTCTC -3'
Posted On2014-01-29