Incidental Mutation 'R1261:Tmprss11d'
ID151597
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86309380 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000113079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175] [ENSMUST00000122377]
Predicted Effect probably benign
Transcript: ENSMUST00000031175
AA Change: D278G

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: D278G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122377
AA Change: D140G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113079
Gene: ENSMUSG00000061259
AA Change: D140G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 47 273 1.29e-86 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2036:Tmprss11d UTSW 5 86309269 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5077:Tmprss11d UTSW 5 86309263 critical splice donor site probably null
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5350:Tmprss11d UTSW 5 86338887 missense probably benign 0.08
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R6778:Tmprss11d UTSW 5 86309350 missense probably benign 0.34
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7273:Tmprss11d UTSW 5 86337239 missense probably damaging 1.00
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
R7627:Tmprss11d UTSW 5 86309506 missense possibly damaging 0.73
R7742:Tmprss11d UTSW 5 86303634 missense probably damaging 0.98
R7937:Tmprss11d UTSW 5 86309490 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTGTTTCCTCATCTGAGAACTGAC -3'
(R):5'- ACCCATGTGAAGTGATGTTGAATTCCC -3'

Sequencing Primer
(F):5'- ttagtggtataagcctgtatcctc -3'
(R):5'- TACAATGAGCCCTAGGCTGA -3'
Posted On2014-01-29