Incidental Mutation 'R1261:Bmp3'
ID151598
Institutional Source Beutler Lab
Gene Symbol Bmp3
Ensembl Gene ENSMUSG00000029335
Gene Namebone morphogenetic protein 3
Synonyms9530029I04Rik
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location98854415-98884396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98879926 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 468 (R468S)
Ref Sequence ENSEMBL: ENSMUSP00000031278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031278] [ENSMUST00000200388]
Predicted Effect probably damaging
Transcript: ENSMUST00000031278
AA Change: R468S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031278
Gene: ENSMUSG00000029335
AA Change: R468S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 34 231 7.9e-9 PFAM
TGFB 366 468 6.17e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200388
SMART Domains Protein: ENSMUSP00000142907
Gene: ENSMUSG00000029335

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 40 227 1.4e-9 PFAM
TGFB 366 442 3.9e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein suppresses osteoblast differentiation, and negatively regulates bone density, by modulating TGF-beta receptor availability to other ligands. Homozygous knockout mice for this gene exhibit increased bone density and volume, while overexpression of this gene in a transgenic mouse causes bone defects resulting in spontaneous rib fractures. This gene encodes distinct protein isoforms that may be similarly proteolytically processed. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in increased bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Bmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Bmp3 APN 5 98872379 missense possibly damaging 0.47
IGL02396:Bmp3 APN 5 98872719 missense possibly damaging 0.47
IGL03058:Bmp3 APN 5 98872094 missense probably damaging 1.00
IGL03189:Bmp3 APN 5 98872720 missense probably benign 0.23
IGL03400:Bmp3 APN 5 98872098 missense probably damaging 1.00
PIT4377001:Bmp3 UTSW 5 98879749 missense unknown
R0139:Bmp3 UTSW 5 98879909 missense possibly damaging 0.72
R0653:Bmp3 UTSW 5 98872111 missense probably damaging 1.00
R0881:Bmp3 UTSW 5 98872602 missense possibly damaging 0.95
R1413:Bmp3 UTSW 5 98872405 missense probably damaging 0.98
R1481:Bmp3 UTSW 5 98872470 missense probably damaging 1.00
R3009:Bmp3 UTSW 5 98879837 missense probably damaging 1.00
R4507:Bmp3 UTSW 5 98879774 missense probably damaging 1.00
R4750:Bmp3 UTSW 5 98872558 missense possibly damaging 0.89
R4833:Bmp3 UTSW 5 98855207 missense probably damaging 1.00
R4921:Bmp3 UTSW 5 98872061 missense probably damaging 1.00
R5022:Bmp3 UTSW 5 98872824 missense probably damaging 1.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R7179:Bmp3 UTSW 5 98872763 missense probably damaging 1.00
R7448:Bmp3 UTSW 5 98872218 missense probably damaging 0.96
R7880:Bmp3 UTSW 5 98872575 missense probably damaging 1.00
R8171:Bmp3 UTSW 5 98872669 missense probably damaging 1.00
R8353:Bmp3 UTSW 5 98855423 critical splice donor site probably null
R8378:Bmp3 UTSW 5 98855389 missense probably damaging 1.00
R8453:Bmp3 UTSW 5 98855423 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATTGTCTGTGACGAGACCCGAG -3'
(R):5'- AGCCTAAGGCAAGACACCTAGTGAG -3'

Sequencing Primer
(F):5'- GAGAGCGGCTTCACCTAAC -3'
(R):5'- CCTGCTATCAAACATCTTTTGGGAC -3'
Posted On2014-01-29