Incidental Mutation 'R1261:Klk5'
ID151603
Institutional Source Beutler Lab
Gene Symbol Klk5
Ensembl Gene ENSMUSG00000074155
Gene Namekallikrein related-peptidase 5
Synonyms
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43841971-43851181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43845290 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000049339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048444] [ENSMUST00000205919]
Predicted Effect probably damaging
Transcript: ENSMUST00000048444
AA Change: S66P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049339
Gene: ENSMUSG00000074155
AA Change: S66P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Tryp_SPc 67 286 9.24e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205919
AA Change: S66P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Klk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Klk5 APN 7 43850822 missense probably damaging 0.99
R1209:Klk5 UTSW 7 43846998 missense probably damaging 0.99
R1227:Klk5 UTSW 7 43847246 splice site probably null
R3700:Klk5 UTSW 7 43850827 missense probably damaging 1.00
R4612:Klk5 UTSW 7 43845272 missense possibly damaging 0.66
R4825:Klk5 UTSW 7 43845390 missense probably damaging 1.00
R7456:Klk5 UTSW 7 43850831 missense probably benign 0.02
R7556:Klk5 UTSW 7 43847225 missense probably damaging 0.99
RF024:Klk5 UTSW 7 43842374 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGAGCCTAAGCCCCTTTCTGAACC -3'
(R):5'- CCAGTGTTGAGATCAGCTCTTCCC -3'

Sequencing Primer
(F):5'- TTCTGAACCCCACCTCTAGAC -3'
(R):5'- tccatccatctttccacctttc -3'
Posted On2014-01-29