Mutagenetix > Incidental Mutation

Incidental Mutation 'R1261:Lrriq1'

151607

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

Gm1557, LOC380658, 4930503E15Rik

MMRRC Submission

039328-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R1261 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102881892-103072183 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103069998 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 6 (D6G)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020043
AA Change: D6G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: D6G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123364
AA Change: D6G

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: D6G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166240
AA Change: D6G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: D6G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,912,470 (GRCm39)	V114A	probably benign	Het
Arhgef38	T	C	3: 132,866,624 (GRCm39)	E171G	possibly damaging	Het
Arsi	A	G	18: 61,049,743 (GRCm39)	T209A	probably damaging	Het
Bmp3	A	T	5: 99,027,785 (GRCm39)	R468S	probably damaging	Het
Cenpk	T	A	13: 104,367,293 (GRCm39)	V43E	possibly damaging	Het
Chmp7	C	T	14: 69,956,899 (GRCm39)	M336I	probably benign	Het
Cul9	G	T	17: 46,836,708 (GRCm39)	L1106M	probably damaging	Het
Dnajc9	G	A	14: 20,438,765 (GRCm39)		probably null	Het
Enpp3	A	T	10: 24,650,832 (GRCm39)	V768E	probably damaging	Het
Klk1b5	T	C	7: 43,494,714 (GRCm39)	S66P	probably damaging	Het
Myh7b	A	G	2: 155,463,003 (GRCm39)	K453R	probably benign	Het
Nipsnap3b	G	T	4: 53,015,166 (GRCm39)	G71V	probably damaging	Het
Oas1h	A	G	5: 121,009,930 (GRCm39)	E335G	probably benign	Het
Or5g25	A	C	2: 85,478,143 (GRCm39)	I174S	probably damaging	Het
Rfwd3	C	T	8: 112,014,874 (GRCm39)	R326Q	probably damaging	Het
Slc10a1	T	A	12: 81,014,604 (GRCm39)	M39L	probably damaging	Het
Tas1r2	G	A	4: 139,382,599 (GRCm39)	R79Q	probably damaging	Het
Thoc2l	A	G	5: 104,668,501 (GRCm39)	T1008A	probably damaging	Het
Tmprss11d	T	C	5: 86,457,239 (GRCm39)	D140G	possibly damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	102,997,757 (GRCm39)	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103,053,977 (GRCm39)	nonsense	probably null
IGL01637:Lrriq1	APN	10	103,051,489 (GRCm39)	missense	probably benign
IGL02019:Lrriq1	APN	10	103,014,661 (GRCm39)	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103,006,340 (GRCm39)	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103,060,802 (GRCm39)	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103,070,024 (GRCm39)	splice site	probably benign
IGL02408:Lrriq1	APN	10	102,982,142 (GRCm39)	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103,036,500 (GRCm39)	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103,050,880 (GRCm39)	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	102,982,144 (GRCm39)	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	102,980,409 (GRCm39)	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103,057,322 (GRCm39)	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103,063,057 (GRCm39)	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	102,907,055 (GRCm39)	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	102,904,792 (GRCm39)	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	102,904,792 (GRCm39)	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	102,899,279 (GRCm39)	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	102,899,279 (GRCm39)	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103,006,281 (GRCm39)	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103,051,634 (GRCm39)	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103,057,150 (GRCm39)	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	102,904,829 (GRCm39)	splice site	probably null
R0522:Lrriq1	UTSW	10	102,997,638 (GRCm39)	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103,069,905 (GRCm39)	missense	probably benign
R1220:Lrriq1	UTSW	10	102,906,990 (GRCm39)	missense	probably benign	0.05
R1262:Lrriq1	UTSW	10	103,069,998 (GRCm39)	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103,038,376 (GRCm39)	splice site	probably benign
R1642:Lrriq1	UTSW	10	103,050,317 (GRCm39)	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103,050,685 (GRCm39)	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103,006,509 (GRCm39)	nonsense	probably null
R1830:Lrriq1	UTSW	10	102,997,620 (GRCm39)	missense	probably benign
R1843:Lrriq1	UTSW	10	103,063,034 (GRCm39)	splice site	probably null
R2128:Lrriq1	UTSW	10	103,050,718 (GRCm39)	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103,050,718 (GRCm39)	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	102,904,774 (GRCm39)	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103,025,848 (GRCm39)	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103,038,242 (GRCm39)	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103,063,111 (GRCm39)	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103,063,111 (GRCm39)	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103,050,536 (GRCm39)	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	102,980,750 (GRCm39)	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103,050,761 (GRCm39)	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103,050,761 (GRCm39)	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	102,980,750 (GRCm39)	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103,006,294 (GRCm39)	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103,006,717 (GRCm39)	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103,051,972 (GRCm39)	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103,051,972 (GRCm39)	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103,051,967 (GRCm39)	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103,038,225 (GRCm39)	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103,057,288 (GRCm39)	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103,036,424 (GRCm39)	nonsense	probably null
R4663:Lrriq1	UTSW	10	102,899,273 (GRCm39)	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103,051,610 (GRCm39)	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103,006,327 (GRCm39)	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103,057,179 (GRCm39)	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103,057,179 (GRCm39)	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	102,980,739 (GRCm39)	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103,014,649 (GRCm39)	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103,069,899 (GRCm39)	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	102,997,613 (GRCm39)	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103,036,420 (GRCm39)	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103,036,420 (GRCm39)	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103,025,784 (GRCm39)	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103,025,784 (GRCm39)	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103,023,314 (GRCm39)	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103,051,206 (GRCm39)	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103,050,448 (GRCm39)	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103,006,457 (GRCm39)	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103,051,301 (GRCm39)	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103,009,236 (GRCm39)	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103,057,243 (GRCm39)	nonsense	probably null
R6008:Lrriq1	UTSW	10	103,006,325 (GRCm39)	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103,051,395 (GRCm39)	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103,051,618 (GRCm39)	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103,051,312 (GRCm39)	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103,009,254 (GRCm39)	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103,036,559 (GRCm39)	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103,063,045 (GRCm39)	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103,057,293 (GRCm39)	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	102,906,977 (GRCm39)	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103,017,750 (GRCm39)	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103,050,800 (GRCm39)	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103,023,319 (GRCm39)	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103,060,826 (GRCm39)	missense	probably benign
R7241:Lrriq1	UTSW	10	103,051,834 (GRCm39)	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103,059,611 (GRCm39)	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103,051,877 (GRCm39)	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103,057,185 (GRCm39)	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103,050,380 (GRCm39)	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103,050,807 (GRCm39)	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103,036,432 (GRCm39)	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103,036,462 (GRCm39)	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103,051,815 (GRCm39)	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103,051,678 (GRCm39)	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103,051,055 (GRCm39)	nonsense	probably null
R8131:Lrriq1	UTSW	10	103,051,572 (GRCm39)	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	102,992,196 (GRCm39)	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103,006,408 (GRCm39)	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103,069,929 (GRCm39)	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103,050,914 (GRCm39)	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	102,882,016 (GRCm39)	missense
R9013:Lrriq1	UTSW	10	103,050,931 (GRCm39)	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103,051,864 (GRCm39)	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103,050,640 (GRCm39)	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103,057,144 (GRCm39)	missense	probably benign
R9384:Lrriq1	UTSW	10	103,006,458 (GRCm39)	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103,050,761 (GRCm39)	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103,051,250 (GRCm39)	missense	probably benign
R9706:Lrriq1	UTSW	10	102,881,902 (GRCm39)	missense
R9780:Lrriq1	UTSW	10	103,025,824 (GRCm39)	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103,051,565 (GRCm39)	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103,038,307 (GRCm39)	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103,069,946 (GRCm39)	missense	probably damaging	0.99
Z1176:Lrriq1	UTSW	10	103,038,221 (GRCm39)	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103,038,220 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- tgaaAAACGAAAAGCTATGGAGAAACACTTAC -3'
(R):5'- GTCAACCATTATCTGTCACTGTGTGCT -3'

Sequencing Primer
(F):5'- GCTATGGAGAAACACTTACAGTGTC -3'
(R):5'- CTACCTTGTGGAAGATAAGCCTG -3'

Posted On

2014-01-29