Incidental Mutation 'R1261:Cenpk'
ID151609
Institutional Source Beutler Lab
Gene Symbol Cenpk
Ensembl Gene ENSMUSG00000021714
Gene Namecentromere protein K
SynonymsB130045K24Rik, Solt, C530004N04Rik
MMRRC Submission 039328-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R1261 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104228611-104252392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104230785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 43 (V43E)
Ref Sequence ENSEMBL: ENSMUSP00000022227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226] [ENSMUST00000022227] [ENSMUST00000070761] [ENSMUST00000224500] [ENSMUST00000224857] [ENSMUST00000225557]
Predicted Effect probably benign
Transcript: ENSMUST00000022226
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000022227
AA Change: V43E

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022227
Gene: ENSMUSG00000021714
AA Change: V43E

DomainStartEndE-ValueType
Pfam:CENP-K 47 306 1.5e-124 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000070761
AA Change: V8E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070910
Gene: ENSMUSG00000021714
AA Change: V8E

DomainStartEndE-ValueType
Pfam:CENP-K 1 231 1.1e-99 PFAM
low complexity region 237 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224179
Predicted Effect possibly damaging
Transcript: ENSMUST00000224500
AA Change: V8E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224857
AA Change: V8E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225557
AA Change: V8E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225798
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Arhgef38 T C 3: 133,160,863 E171G possibly damaging Het
Arsi A G 18: 60,916,671 T209A probably damaging Het
BC005561 A G 5: 104,520,635 T1008A probably damaging Het
Bmp3 A T 5: 98,879,926 R468S probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 G T 17: 46,525,782 L1106M probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Enpp3 A T 10: 24,774,934 V768E probably damaging Het
Klk5 T C 7: 43,845,290 S66P probably damaging Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Myh7b A G 2: 155,621,083 K453R probably benign Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Oas1h A G 5: 120,871,867 E335G probably benign Het
Olfr1002 A C 2: 85,647,799 I174S probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc10a1 T A 12: 80,967,830 M39L probably damaging Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Tmprss11d T C 5: 86,309,380 D140G possibly damaging Het
Other mutations in Cenpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cenpk APN 13 104236234 unclassified probably benign
IGL02885:Cenpk APN 13 104249395 missense probably damaging 0.97
IGL03107:Cenpk APN 13 104242772 missense probably damaging 0.99
IGL03122:Cenpk APN 13 104242377 missense probably damaging 1.00
R0421:Cenpk UTSW 13 104242403 missense probably benign 0.36
R0423:Cenpk UTSW 13 104234225 missense probably benign 0.00
R1262:Cenpk UTSW 13 104230785 missense possibly damaging 0.90
R2069:Cenpk UTSW 13 104236176 unclassified probably benign
R2105:Cenpk UTSW 13 104229597 nonsense probably null
R2183:Cenpk UTSW 13 104234163 missense probably damaging 0.99
R2509:Cenpk UTSW 13 104234167 splice site probably null
R4625:Cenpk UTSW 13 104249393 missense possibly damaging 0.86
R4755:Cenpk UTSW 13 104230871 missense probably benign 0.02
R4755:Cenpk UTSW 13 104249512 missense probably benign 0.06
R5217:Cenpk UTSW 13 104249409 missense probably damaging 1.00
R5865:Cenpk UTSW 13 104236194 makesense probably null
R6928:Cenpk UTSW 13 104228992 start gained probably benign
R7109:Cenpk UTSW 13 104230748 missense probably benign 0.44
R7444:Cenpk UTSW 13 104249517 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCTATTTCTCTGAACCCTGACCCC -3'
(R):5'- GCGGAAACTAACACGGTTTCTTTCCTA -3'

Sequencing Primer
(F):5'- tcttaccaatacatctcctcacc -3'
(R):5'- ACGGTTTCTTTCCTAAGTCAATTATG -3'
Posted On2014-01-29