Incidental Mutation 'R1262:Nipsnap3b'
ID 151616
Institutional Source Beutler Lab
Gene Symbol Nipsnap3b
Ensembl Gene ENSMUSG00000015247
Gene Name nipsnap homolog 3B
Synonyms
MMRRC Submission 039329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1262 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 53011880-53022060 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 53015166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 71 (G71V)
Ref Sequence ENSEMBL: ENSMUSP00000103292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015391] [ENSMUST00000107665]
AlphaFold Q9CQE1
Predicted Effect probably damaging
Transcript: ENSMUST00000015391
AA Change: G71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015391
Gene: ENSMUSG00000015247
AA Change: G71V

DomainStartEndE-ValueType
Pfam:NIPSNAP 37 136 1.5e-32 PFAM
Pfam:NIPSNAP 146 245 5.5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107665
AA Change: G71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103292
Gene: ENSMUSG00000015247
AA Change: G71V

DomainStartEndE-ValueType
Pfam:NIPSNAP 37 136 2.2e-30 PFAM
Pfam:NIPSNAP 134 195 8.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NIPSNAP3A belongs to a family of proteins with putative roles in vesicular transport (Buechler et al., 2004 [PubMed 15177564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
BC048679 A G 7: 81,495,341 F85L probably benign Het
Btbd7 A G 12: 102,787,951 I852T probably benign Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cyp2b10 C T 7: 25,915,411 T281M probably benign Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Olfr623 G A 7: 103,660,441 P270S probably benign Het
Olfr648 A G 7: 104,179,416 probably null Het
Snx25 T A 8: 46,105,291 R80S probably damaging Het
Syt6 A T 3: 103,585,340 probably null Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Ttc7 C T 17: 87,340,936 T521I probably benign Het
Other mutations in Nipsnap3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Nipsnap3b APN 4 53015016 missense possibly damaging 0.80
R0008:Nipsnap3b UTSW 4 53015112 missense probably damaging 1.00
R0008:Nipsnap3b UTSW 4 53015112 missense probably damaging 1.00
R0148:Nipsnap3b UTSW 4 53017088 missense possibly damaging 0.56
R0518:Nipsnap3b UTSW 4 53021343 missense probably damaging 0.99
R1261:Nipsnap3b UTSW 4 53015166 missense probably damaging 1.00
R1954:Nipsnap3b UTSW 4 53017213 splice site probably benign
R5861:Nipsnap3b UTSW 4 53021177 missense probably damaging 1.00
R6213:Nipsnap3b UTSW 4 53017066 missense probably benign 0.01
R6950:Nipsnap3b UTSW 4 53015136 missense possibly damaging 0.90
R7076:Nipsnap3b UTSW 4 53021095 splice site probably null
R8397:Nipsnap3b UTSW 4 53012049 critical splice donor site probably null
R9125:Nipsnap3b UTSW 4 53021177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATGTTCACCTTTTGCTACAGGC -3'
(R):5'- CACGAGGACATTCTCAATTCCTCTGC -3'

Sequencing Primer
(F):5'- TTTTGCTACAGGCCCCAGG -3'
(R):5'- AAGCTGATGGTCAGATATCCTCTC -3'
Posted On 2014-01-29