Mutagenetix > Incidental Mutations

Incidental Mutation 'R1262:Tas1r2'

151617

Institutional Source

Beutler Lab

Gene Symbol

Tas1r2

Ensembl Gene

ENSMUSG00000028738

Gene Name

taste receptor, type 1, member 2

Synonyms

Gpr71, TR2, T1r2

MMRRC Submission

039329-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R1262 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139653538-139670280 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 139655288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 79 (R79Q)

Ref Sequence

ENSEMBL: ENSMUSP00000030510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030510] [ENSMUST00000166773] [ENSMUST00000178644]

AlphaFold

Q925I4

Predicted Effect

probably damaging
Transcript: ENSMUST00000030510
AA Change: R79Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030510
Gene: ENSMUSG00000028738
AA Change: R79Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	73	459	2e-90	PFAM
Pfam:NCD3G	495	548	2.4e-17	PFAM
Pfam:7tm_3	581	818	2.8e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166773
AA Change: R79Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127737
Gene: ENSMUSG00000028738
AA Change: R79Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	73	213	5.3e-38	PFAM
Pfam:ANF_receptor	217	429	8.4e-31	PFAM
Pfam:NCD3G	466	519	7.4e-19	PFAM
Pfam:7tm_3	550	790	3e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000178644

SMART Domains

Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

Domain	Start	End	E-Value	Type
SCOP:d1lbva_	1	60	5e-3	SMART
Pfam:Filament	165	253	7.3e-13	PFAM
low complexity region	255	268	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to sweet tastants. Response to umami tastants is unimpaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,935,488	V114A	probably benign	Het
BC048679	A	G	7: 81,495,341	F85L	probably benign	Het
Btbd7	A	G	12: 102,787,951	I852T	probably benign	Het
Cenpk	T	A	13: 104,230,785	V43E	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cyp2b10	C	T	7: 25,915,411	T281M	probably benign	Het
Lrriq1	T	C	10: 103,234,137	D6G	possibly damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Nipsnap3b	G	T	4: 53,015,166	G71V	probably damaging	Het
Olfr623	G	A	7: 103,660,441	P270S	probably benign	Het
Olfr648	A	G	7: 104,179,416		probably null	Het
Snx25	T	A	8: 46,105,291	R80S	probably damaging	Het
Syt6	A	T	3: 103,585,340		probably null	Het
Ttc7	C	T	17: 87,340,936	T521I	probably benign	Het

Other mutations in Tas1r2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Tas1r2	APN	4	139660291	missense	probably benign	0.03
IGL00952:Tas1r2	APN	4	139655252	missense	probably benign	0.00
IGL00972:Tas1r2	APN	4	139660036	missense	probably damaging	0.99
IGL01939:Tas1r2	APN	4	139669177	missense	probably damaging	1.00
IGL02247:Tas1r2	APN	4	139669516	missense	probably damaging	1.00
IGL02663:Tas1r2	APN	4	139660282	missense	probably benign
IGL03155:Tas1r2	APN	4	139669156	missense	possibly damaging	0.95
R0395:Tas1r2	UTSW	4	139655354	missense	possibly damaging	0.86
R0798:Tas1r2	UTSW	4	139669713	missense	probably damaging	1.00
R1221:Tas1r2	UTSW	4	139669125	missense	probably benign	0.00
R1223:Tas1r2	UTSW	4	139660204	missense	probably damaging	1.00
R1261:Tas1r2	UTSW	4	139655288	missense	probably damaging	0.99
R1330:Tas1r2	UTSW	4	139669329	missense	probably benign	0.05
R1466:Tas1r2	UTSW	4	139669411	missense	probably damaging	1.00
R1466:Tas1r2	UTSW	4	139669411	missense	probably damaging	1.00
R1879:Tas1r2	UTSW	4	139669695	missense	probably damaging	1.00
R2112:Tas1r2	UTSW	4	139655355	missense	probably benign	0.00
R2156:Tas1r2	UTSW	4	139669041	missense	possibly damaging	0.79
R2509:Tas1r2	UTSW	4	139659851	missense	probably damaging	1.00
R2510:Tas1r2	UTSW	4	139659851	missense	probably damaging	1.00
R2511:Tas1r2	UTSW	4	139659851	missense	probably damaging	1.00
R3429:Tas1r2	UTSW	4	139669575	missense	probably damaging	1.00
R3430:Tas1r2	UTSW	4	139669575	missense	probably damaging	1.00
R3703:Tas1r2	UTSW	4	139667418	missense	probably damaging	1.00
R4105:Tas1r2	UTSW	4	139660052	missense	probably benign	0.06
R4106:Tas1r2	UTSW	4	139660052	missense	probably benign	0.06
R4107:Tas1r2	UTSW	4	139660052	missense	probably benign	0.06
R4614:Tas1r2	UTSW	4	139659787	missense	probably damaging	1.00
R4811:Tas1r2	UTSW	4	139669000	missense	probably damaging	1.00
R5314:Tas1r2	UTSW	4	139655361	missense	probably damaging	1.00
R5461:Tas1r2	UTSW	4	139660009	missense	probably benign	0.01
R5639:Tas1r2	UTSW	4	139659796	missense	probably damaging	1.00
R5703:Tas1r2	UTSW	4	139667336	missense	probably damaging	1.00
R6176:Tas1r2	UTSW	4	139668888	missense	probably damaging	1.00
R6297:Tas1r2	UTSW	4	139662050	missense	possibly damaging	0.47
R6441:Tas1r2	UTSW	4	139669156	missense	probably damaging	0.99
R6748:Tas1r2	UTSW	4	139669611	missense	probably damaging	0.98
R6863:Tas1r2	UTSW	4	139669719	missense	probably damaging	1.00
R6975:Tas1r2	UTSW	4	139669720	missense	probably damaging	1.00
R7106:Tas1r2	UTSW	4	139662049	missense	probably benign
R7265:Tas1r2	UTSW	4	139669652	missense	probably benign	0.01
R7580:Tas1r2	UTSW	4	139659745	missense	probably benign	0.05
R7651:Tas1r2	UTSW	4	139669627	missense	probably benign	0.14
R8041:Tas1r2	UTSW	4	139659979	missense	possibly damaging	0.65
R8530:Tas1r2	UTSW	4	139662149	missense	probably benign
R8747:Tas1r2	UTSW	4	139660007	missense	probably benign
R8824:Tas1r2	UTSW	4	139653763	splice site	probably benign
R8904:Tas1r2	UTSW	4	139667403	missense	probably damaging	1.00
R8906:Tas1r2	UTSW	4	139669735	missense	probably damaging	1.00
R9315:Tas1r2	UTSW	4	139653735	missense	possibly damaging	0.91
R9336:Tas1r2	UTSW	4	139662005	missense	probably damaging	1.00
R9419:Tas1r2	UTSW	4	139659725	missense	possibly damaging	0.65
Z1088:Tas1r2	UTSW	4	139660424	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCACTGTGGACAATGGTAGGGGTC -3'
(R):5'- ATCACCTGTGGCACGAGGAAGTAG -3'

Sequencing Primer
(F):5'- GAATGCAGTAAGTGCCAGAACTTTC -3'
(R):5'- AATGACGGCCACCACTTGG -3'

Posted On

2014-01-29