Incidental Mutation 'R1262:BC048679'
ID 151624
Institutional Source Beutler Lab
Gene Symbol BC048679
Ensembl Gene ENSMUSG00000061877
Gene Name cDNA sequence BC048679
Synonyms
MMRRC Submission 039329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R1262 (G1)
Quality Score 152
Status Not validated
Chromosome 7
Chromosomal Location 81494275-81498281 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81495341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 85 (F85L)
Ref Sequence ENSEMBL: ENSMUSP00000147131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073406] [ENSMUST00000082090] [ENSMUST00000144156] [ENSMUST00000152355] [ENSMUST00000207871]
AlphaFold D3YXE9
Predicted Effect probably benign
Transcript: ENSMUST00000073406
SMART Domains Protein: ENSMUSP00000073114
Gene: ENSMUSG00000061877

DomainStartEndE-ValueType
Pfam:NLPC_P60 3 101 6.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082090
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119121
SMART Domains Protein: ENSMUSP00000114032
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 122 5.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144156
AA Change: F91L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120616
Gene: ENSMUSG00000061877
AA Change: F91L

DomainStartEndE-ValueType
low complexity region 108 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Predicted Effect probably benign
Transcript: ENSMUST00000207871
AA Change: F85L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208911
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
Btbd7 A G 12: 102,787,951 I852T probably benign Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cyp2b10 C T 7: 25,915,411 T281M probably benign Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Olfr623 G A 7: 103,660,441 P270S probably benign Het
Olfr648 A G 7: 104,179,416 probably null Het
Snx25 T A 8: 46,105,291 R80S probably damaging Het
Syt6 A T 3: 103,585,340 probably null Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Ttc7 C T 17: 87,340,936 T521I probably benign Het
Other mutations in BC048679
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02811:BC048679 APN 7 81495189 unclassified probably benign
R0427:BC048679 UTSW 7 81495245 missense probably benign 0.02
R4860:BC048679 UTSW 7 81495720 missense probably benign 0.03
R4860:BC048679 UTSW 7 81495720 missense probably benign 0.03
R5242:BC048679 UTSW 7 81495343 missense probably damaging 0.97
R5972:BC048679 UTSW 7 81495731 missense probably damaging 1.00
R6050:BC048679 UTSW 7 81495591 missense possibly damaging 0.46
R6332:BC048679 UTSW 7 81495218 missense probably benign 0.37
R6804:BC048679 UTSW 7 81496864 missense possibly damaging 0.90
R8509:BC048679 UTSW 7 81495368 missense probably benign 0.01
R9197:BC048679 UTSW 7 81495218 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGCCCAACAGGTTCAGTGCAAAG -3'
(R):5'- TGCGGCCAAGGAGAGATCATACAC -3'

Sequencing Primer
(F):5'- TGCACACAGTTGCTGCTA -3'
(R):5'- ATCATACACTTTGAGGGTGAGC -3'
Posted On 2014-01-29