Incidental Mutation 'R1262:Olfr623'
ID 151625
Institutional Source Beutler Lab
Gene Symbol Olfr623
Ensembl Gene ENSMUSG00000099687
Gene Name olfactory receptor 623
Synonyms MOR1-4, GA_x6K02T2PBJ9-6384836-6383883
MMRRC Submission 039329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R1262 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103657697-103663698 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103660441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 270 (P270S)
Ref Sequence ENSEMBL: ENSMUSP00000150141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068531] [ENSMUST00000213840]
AlphaFold E9Q382
Predicted Effect probably benign
Transcript: ENSMUST00000068531
AA Change: P270S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: P270S

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1.7e-112 PFAM
Pfam:7TM_GPCR_Srsx 36 299 3.1e-7 PFAM
Pfam:7tm_1 42 293 2.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213840
AA Change: P270S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
BC048679 A G 7: 81,495,341 F85L probably benign Het
Btbd7 A G 12: 102,787,951 I852T probably benign Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cyp2b10 C T 7: 25,915,411 T281M probably benign Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Olfr648 A G 7: 104,179,416 probably null Het
Snx25 T A 8: 46,105,291 R80S probably damaging Het
Syt6 A T 3: 103,585,340 probably null Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Ttc7 C T 17: 87,340,936 T521I probably benign Het
Other mutations in Olfr623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr623 APN 7 103661067 missense probably damaging 0.99
IGL01669:Olfr623 APN 7 103660987 missense probably benign 0.02
IGL01731:Olfr623 APN 7 103660846 missense probably benign 0.01
IGL02057:Olfr623 APN 7 103660653 missense probably damaging 1.00
IGL02249:Olfr623 APN 7 103660366 missense probably damaging 0.99
IGL02937:Olfr623 APN 7 103660905 missense probably damaging 1.00
IGL03113:Olfr623 APN 7 103660644 missense possibly damaging 0.90
R0413:Olfr623 UTSW 7 103660750 missense possibly damaging 0.52
R0862:Olfr623 UTSW 7 103660528 missense probably damaging 1.00
R1791:Olfr623 UTSW 7 103660798 splice site probably null
R2327:Olfr623 UTSW 7 103660572 missense probably damaging 1.00
R2338:Olfr623 UTSW 7 103660410 missense possibly damaging 0.90
R4521:Olfr623 UTSW 7 103660332 missense probably benign 0.01
R4831:Olfr623 UTSW 7 103660471 missense probably benign 0.40
R5322:Olfr623 UTSW 7 103660672 missense possibly damaging 0.62
R6270:Olfr623 UTSW 7 103660413 missense possibly damaging 0.48
R6959:Olfr623 UTSW 7 103660843 missense probably damaging 1.00
R7157:Olfr623 UTSW 7 103660581 missense probably damaging 1.00
R7181:Olfr623 UTSW 7 103660813 missense probably damaging 0.99
R7570:Olfr623 UTSW 7 103660881 missense probably damaging 1.00
R9037:Olfr623 UTSW 7 103661175 missense probably benign 0.32
R9234:Olfr623 UTSW 7 103660743 missense possibly damaging 0.96
X0066:Olfr623 UTSW 7 103660660 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGCTGTGTCAAGCTCATTTGACTCTG -3'
(R):5'- TGTGCTGACATCACATTCAATCGTCTC -3'

Sequencing Primer
(F):5'- TTAGCCCTAGATAAGTGACAGC -3'
(R):5'- GACATCACATTCAATCGTCTCTATCC -3'
Posted On 2014-01-29