Mutagenetix > Incidental Mutations

Incidental Mutation 'R1262:Olfr623'

151625

Institutional Source

Beutler Lab

Gene Symbol

Olfr623

Ensembl Gene

ENSMUSG00000099687

Gene Name

olfactory receptor 623

Synonyms

MOR1-4, GA_x6K02T2PBJ9-6384836-6383883

MMRRC Submission

039329-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R1262 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103657697-103663698 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103660441 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 270 (P270S)

Ref Sequence

ENSEMBL: ENSMUSP00000150141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068531] [ENSMUST00000213840]

Predicted Effect

probably benign
Transcript: ENSMUST00000068531
AA Change: P270S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: P270S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	310	1.7e-112	PFAM
Pfam:7TM_GPCR_Srsx	36	299	3.1e-7	PFAM
Pfam:7tm_1	42	293	2.6e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213840
AA Change: P270S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,935,488	V114A	probably benign	Het
BC048679	A	G	7: 81,495,341	F85L	probably benign	Het
Btbd7	A	G	12: 102,787,951	I852T	probably benign	Het
Cenpk	T	A	13: 104,230,785	V43E	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cyp2b10	C	T	7: 25,915,411	T281M	probably benign	Het
Lrriq1	T	C	10: 103,234,137	D6G	possibly damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Nipsnap3b	G	T	4: 53,015,166	G71V	probably damaging	Het
Olfr648	A	G	7: 104,179,416		probably null	Het
Snx25	T	A	8: 46,105,291	R80S	probably damaging	Het
Syt6	A	T	3: 103,585,340		probably null	Het
Tas1r2	G	A	4: 139,655,288	R79Q	probably damaging	Het
Ttc7	C	T	17: 87,340,936	T521I	probably benign	Het

Other mutations in Olfr623

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Olfr623	APN	7	103661067	missense	probably damaging	0.99
IGL01669:Olfr623	APN	7	103660987	missense	probably benign	0.02
IGL01731:Olfr623	APN	7	103660846	missense	probably benign	0.01
IGL02057:Olfr623	APN	7	103660653	missense	probably damaging	1.00
IGL02249:Olfr623	APN	7	103660366	missense	probably damaging	0.99
IGL02937:Olfr623	APN	7	103660905	missense	probably damaging	1.00
IGL03113:Olfr623	APN	7	103660644	missense	possibly damaging	0.90
R0413:Olfr623	UTSW	7	103660750	missense	possibly damaging	0.52
R0862:Olfr623	UTSW	7	103660528	missense	probably damaging	1.00
R1791:Olfr623	UTSW	7	103660798	splice site	probably null
R2327:Olfr623	UTSW	7	103660572	missense	probably damaging	1.00
R2338:Olfr623	UTSW	7	103660410	missense	possibly damaging	0.90
R4521:Olfr623	UTSW	7	103660332	missense	probably benign	0.01
R4831:Olfr623	UTSW	7	103660471	missense	probably benign	0.40
R5322:Olfr623	UTSW	7	103660672	missense	possibly damaging	0.62
R6270:Olfr623	UTSW	7	103660413	missense	possibly damaging	0.48
R6959:Olfr623	UTSW	7	103660843	missense	probably damaging	1.00
R7157:Olfr623	UTSW	7	103660581	missense	probably damaging	1.00
R7181:Olfr623	UTSW	7	103660813	missense	probably damaging	0.99
R7570:Olfr623	UTSW	7	103660881	missense	probably damaging	1.00
X0066:Olfr623	UTSW	7	103660660	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- GGCTGTGTCAAGCTCATTTGACTCTG -3'
(R):5'- TGTGCTGACATCACATTCAATCGTCTC -3'

Sequencing Primer
(F):5'- TTAGCCCTAGATAAGTGACAGC -3'
(R):5'- GACATCACATTCAATCGTCTCTATCC -3'

Posted On

2014-01-29