Mutagenetix > Incidental Mutations

Incidental Mutation 'R1262:Btbd7'

151628

Institutional Source

Beutler Lab

Gene Symbol

Btbd7

Ensembl Gene

ENSMUSG00000041702

Gene Name

BTB (POZ) domain containing 7

Synonyms

FUP1, E130118E17Rik, 5730507E09Rik

MMRRC Submission

039329-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.414) question?

Stock #

R1262 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102780797-102878471 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102787951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 852 (I852T)

Ref Sequence

ENSEMBL: ENSMUSP00000152426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]

AlphaFold

Q8CFE5

Predicted Effect

probably benign
Transcript: ENSMUST00000045652
AA Change: I852T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: I852T

Domain	Start	End	E-Value	Type
BTB	142	244	1.57e-13	SMART
BTB	247	397	2.23e-4	SMART
BACK	402	538	1.49e-4	SMART
low complexity region	626	640	N/A	INTRINSIC
low complexity region	756	771	N/A	INTRINSIC
low complexity region	783	792	N/A	INTRINSIC
low complexity region	808	822	N/A	INTRINSIC
low complexity region	839	850	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223554
AA Change: I852T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,935,488	V114A	probably benign	Het
BC048679	A	G	7: 81,495,341	F85L	probably benign	Het
Cenpk	T	A	13: 104,230,785	V43E	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cyp2b10	C	T	7: 25,915,411	T281M	probably benign	Het
Lrriq1	T	C	10: 103,234,137	D6G	possibly damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Nipsnap3b	G	T	4: 53,015,166	G71V	probably damaging	Het
Olfr623	G	A	7: 103,660,441	P270S	probably benign	Het
Olfr648	A	G	7: 104,179,416		probably null	Het
Snx25	T	A	8: 46,105,291	R80S	probably damaging	Het
Syt6	A	T	3: 103,585,340		probably null	Het
Tas1r2	G	A	4: 139,655,288	R79Q	probably damaging	Het
Ttc7	C	T	17: 87,340,936	T521I	probably benign	Het

Other mutations in Btbd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02047:Btbd7	APN	12	102793779	missense	probably benign	0.10
IGL02899:Btbd7	APN	12	102837662	missense	probably damaging	1.00
IGL03204:Btbd7	APN	12	102807980	nonsense	probably null
H8562:Btbd7	UTSW	12	102788302	missense	probably benign	0.26
IGL03050:Btbd7	UTSW	12	102812806	missense	probably benign	0.03
R1423:Btbd7	UTSW	12	102785475	missense	possibly damaging	0.49
R1437:Btbd7	UTSW	12	102788090	missense	possibly damaging	0.59
R1636:Btbd7	UTSW	12	102793851	missense	probably damaging	1.00
R1641:Btbd7	UTSW	12	102790775	missense	probably damaging	1.00
R1722:Btbd7	UTSW	12	102812654	missense	possibly damaging	0.96
R1921:Btbd7	UTSW	12	102793796	missense	probably benign	0.01
R2021:Btbd7	UTSW	12	102790709	missense	probably damaging	1.00
R2180:Btbd7	UTSW	12	102785897	missense	probably damaging	1.00
R3768:Btbd7	UTSW	12	102795192	missense	probably damaging	1.00
R3770:Btbd7	UTSW	12	102795192	missense	probably damaging	1.00
R3786:Btbd7	UTSW	12	102838152	missense	probably benign	0.22
R4396:Btbd7	UTSW	12	102785293	missense	probably benign	0.00
R4809:Btbd7	UTSW	12	102793744	critical splice donor site	probably null
R4910:Btbd7	UTSW	12	102808048	missense	probably damaging	0.98
R4915:Btbd7	UTSW	12	102837787	nonsense	probably null
R5054:Btbd7	UTSW	12	102838212	missense	probably benign	0.02
R5276:Btbd7	UTSW	12	102838392	missense	probably benign	0.00
R5387:Btbd7	UTSW	12	102837785	missense	probably damaging	0.99
R5665:Btbd7	UTSW	12	102785197	missense	probably benign
R7083:Btbd7	UTSW	12	102788335	missense	probably damaging	0.99
R7354:Btbd7	UTSW	12	102838205	missense	probably benign	0.05
R7429:Btbd7	UTSW	12	102837780	missense	probably damaging	1.00
R7462:Btbd7	UTSW	12	102837722	missense	possibly damaging	0.88
R7469:Btbd7	UTSW	12	102812768	missense	probably damaging	0.99
R7998:Btbd7	UTSW	12	102795240	missense	probably damaging	1.00
R8499:Btbd7	UTSW	12	102788372	missense	probably damaging	1.00
R8773:Btbd7	UTSW	12	102837982	missense	probably benign	0.02
R8783:Btbd7	UTSW	12	102788242	missense	probably benign	0.45
R8968:Btbd7	UTSW	12	102812766	missense	probably damaging	1.00
R9016:Btbd7	UTSW	12	102785158	missense	probably damaging	1.00
R9027:Btbd7	UTSW	12	102838579	missense	probably damaging	1.00
R9216:Btbd7	UTSW	12	102795304	missense	probably damaging	1.00
R9221:Btbd7	UTSW	12	102811171	missense	probably damaging	1.00
X0024:Btbd7	UTSW	12	102812686	nonsense	probably null
X0025:Btbd7	UTSW	12	102811164	missense	probably benign	0.06
Z1177:Btbd7	UTSW	12	102811120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGAGAAGCTCCCAGCTAGTCAG -3'
(R):5'- GAGATGTCGTGTCAACAGTACCCC -3'

Sequencing Primer
(F):5'- CCAGCTAGTCAGTAACACTTCTG -3'
(R):5'- GAAACCATGTTTACAGACCTGG -3'

Posted On

2014-01-29