Incidental Mutation 'R1262:Ttc7'
ID 151633
Institutional Source Beutler Lab
Gene Symbol Ttc7
Ensembl Gene ENSMUSG00000036918
Gene Name tetratricopeptide repeat domain 7
Synonyms 1110035E02Rik, fsn, hea, 1700007L07Rik
MMRRC Submission 039329-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock # R1262 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 87282886-87381769 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 87340936 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 521 (T521I)
Ref Sequence ENSEMBL: ENSMUSP00000115351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041110] [ENSMUST00000125875] [ENSMUST00000144204] [ENSMUST00000154255]
AlphaFold Q8BGB2
Predicted Effect probably benign
Transcript: ENSMUST00000041110
AA Change: T521I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040771
Gene: ENSMUSG00000036918
AA Change: T521I

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 8.7e-4 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
TPR 779 812 9.99e1 SMART
TPR 813 846 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125875
AA Change: T521I

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115351
Gene: ENSMUSG00000036918
AA Change: T521I

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 1.2e-3 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
low complexity region 787 801 N/A INTRINSIC
low complexity region 806 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144204
SMART Domains Protein: ENSMUSP00000122563
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148554
Predicted Effect probably benign
Transcript: ENSMUST00000154255
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeats. Mutations in this gene disrupt intestinal development and can cause early onset inflammatory bowel disease and intestinal atresia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit reduced growth, sparse hair, thickened, scaly skin, increased numbers of splenic B cells, macrophages, and erythroid cells, elevated IgE, glomerulonephritis, and forestomach papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,935,488 V114A probably benign Het
BC048679 A G 7: 81,495,341 F85L probably benign Het
Btbd7 A G 12: 102,787,951 I852T probably benign Het
Cenpk T A 13: 104,230,785 V43E possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cyp2b10 C T 7: 25,915,411 T281M probably benign Het
Lrriq1 T C 10: 103,234,137 D6G possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nipsnap3b G T 4: 53,015,166 G71V probably damaging Het
Olfr623 G A 7: 103,660,441 P270S probably benign Het
Olfr648 A G 7: 104,179,416 probably null Het
Snx25 T A 8: 46,105,291 R80S probably damaging Het
Syt6 A T 3: 103,585,340 probably null Het
Tas1r2 G A 4: 139,655,288 R79Q probably damaging Het
Other mutations in Ttc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ttc7 APN 17 87363564 missense possibly damaging 0.66
IGL00980:Ttc7 APN 17 87321446 missense possibly damaging 0.82
IGL01638:Ttc7 APN 17 87359112 critical splice acceptor site probably null
IGL01896:Ttc7 APN 17 87359124 missense probably damaging 0.99
IGL02643:Ttc7 APN 17 87340899 missense possibly damaging 0.85
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0310:Ttc7 UTSW 17 87361864 missense probably benign 0.00
R0412:Ttc7 UTSW 17 87330044 missense probably benign 0.20
R0520:Ttc7 UTSW 17 87359151 missense possibly damaging 0.93
R1216:Ttc7 UTSW 17 87346578 missense possibly damaging 0.85
R1337:Ttc7 UTSW 17 87290296 missense probably damaging 1.00
R1537:Ttc7 UTSW 17 87322463 missense possibly damaging 0.88
R1586:Ttc7 UTSW 17 87361945 critical splice donor site probably null
R1678:Ttc7 UTSW 17 87361901 missense probably damaging 1.00
R1747:Ttc7 UTSW 17 87307015 missense possibly damaging 0.87
R2146:Ttc7 UTSW 17 87346707 splice site probably benign
R3878:Ttc7 UTSW 17 87370738 intron probably benign
R3934:Ttc7 UTSW 17 87370738 intron probably benign
R4007:Ttc7 UTSW 17 87290251 missense possibly damaging 0.69
R4256:Ttc7 UTSW 17 87321401 critical splice acceptor site probably null
R4671:Ttc7 UTSW 17 87346620 missense probably damaging 1.00
R4676:Ttc7 UTSW 17 87370735 intron probably benign
R4677:Ttc7 UTSW 17 87370735 intron probably benign
R4784:Ttc7 UTSW 17 87340897 missense probably benign 0.03
R4833:Ttc7 UTSW 17 87334321 missense probably damaging 1.00
R4927:Ttc7 UTSW 17 87346705 splice site probably null
R4940:Ttc7 UTSW 17 87306958 missense probably benign 0.02
R5183:Ttc7 UTSW 17 87292878 missense probably damaging 1.00
R5634:Ttc7 UTSW 17 87342087 missense probably benign
R5710:Ttc7 UTSW 17 87290246 missense probably damaging 1.00
R5867:Ttc7 UTSW 17 87322472 missense possibly damaging 0.49
R6437:Ttc7 UTSW 17 87330106 missense probably damaging 1.00
R6982:Ttc7 UTSW 17 87307009 missense probably damaging 1.00
R7299:Ttc7 UTSW 17 87346542 missense possibly damaging 0.68
R7849:Ttc7 UTSW 17 87292946 missense probably null 0.00
R8098:Ttc7 UTSW 17 87334328 missense probably benign 0.21
R8471:Ttc7 UTSW 17 87294026 missense probably benign 0.24
R8889:Ttc7 UTSW 17 87330092 missense probably damaging 1.00
R8892:Ttc7 UTSW 17 87330092 missense probably damaging 1.00
R9225:Ttc7 UTSW 17 87330074 missense probably damaging 1.00
R9427:Ttc7 UTSW 17 87370719 intron probably benign
R9436:Ttc7 UTSW 17 87292892 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTATCCTGTTACTGTACCCCGAGG -3'
(R):5'- AGAAAGCCAACTGTGAGCTGACC -3'

Sequencing Primer
(F):5'- TGTACCCCGAGGTTGCAC -3'
(R):5'- TCCAGTGCCCAGGGTTAAG -3'
Posted On 2014-01-29