Incidental Mutation 'R1263:Chil1'
ID151638
Institutional Source Beutler Lab
Gene Symbol Chil1
Ensembl Gene ENSMUSG00000064246
Gene Namechitinase-like 1
SynonymsBrp39, Gp39, Chi3l1
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134182176-134190181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134189242 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 315 (E315K)
Ref Sequence ENSEMBL: ENSMUSP00000117117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038445] [ENSMUST00000082060] [ENSMUST00000132873] [ENSMUST00000133701] [ENSMUST00000153856] [ENSMUST00000156873] [ENSMUST00000191577]
Predicted Effect probably benign
Transcript: ENSMUST00000038445
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082060
AA Change: E323K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000080717
Gene: ENSMUSG00000064246
AA Change: E323K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Glyco_18 30 366 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132873
SMART Domains Protein: ENSMUSP00000118289
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
Pfam:Glyco_hydro_18 2 110 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133701
SMART Domains Protein: ENSMUSP00000121471
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
Pfam:Glyco_hydro_18 2 106 2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144819
Predicted Effect probably benign
Transcript: ENSMUST00000153856
AA Change: E315K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117117
Gene: ENSMUSG00000064246
AA Change: E315K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 358 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156873
AA Change: E313K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119205
Gene: ENSMUSG00000064246
AA Change: E313K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Glyco_18 20 356 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191577
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitinases catalyze the hydrolysis of chitin, which is an abundant glycopolymer found in insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 family of chitinases includes eight human family members. This gene encodes a glycoprotein member of the glycosyl hydrolase 18 family. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. The protein is thought to play a role in the process of inflammation and tissue remodeling. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show impaired OVA-induced Th2 responses with reduced splenocyte proliferation, cytokine production and IgE levels, impaired dendritic cell recruitment, higher CD4 T cell, macrophage and eosinophil apoptosis, and reduced CD4 T cell and alternatively activated macrophage numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Chil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Chil1 APN 1 134187973 missense possibly damaging 0.89
IGL01305:Chil1 APN 1 134182816 splice site probably benign
IGL02051:Chil1 APN 1 134184149 missense probably damaging 1.00
IGL02724:Chil1 APN 1 134189243 missense probably damaging 1.00
IGL02754:Chil1 APN 1 134183601 missense probably damaging 1.00
R0071:Chil1 UTSW 1 134185279 missense probably benign 0.08
R0071:Chil1 UTSW 1 134185279 missense probably benign 0.08
R0662:Chil1 UTSW 1 134188573 missense probably damaging 1.00
R1728:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1729:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1730:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1739:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1762:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1783:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1784:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R1785:Chil1 UTSW 1 134188529 missense probably damaging 1.00
R4992:Chil1 UTSW 1 134188626 missense probably benign 0.03
R5860:Chil1 UTSW 1 134185171 missense probably benign 0.00
R6019:Chil1 UTSW 1 134189572 missense probably benign 0.00
R6320:Chil1 UTSW 1 134182258 start codon destroyed probably null 0.07
R7748:Chil1 UTSW 1 134189228 missense probably benign 0.00
RF012:Chil1 UTSW 1 134185171 missense probably benign
X0025:Chil1 UTSW 1 134183632 missense possibly damaging 0.62
Z1088:Chil1 UTSW 1 134189500 missense probably benign 0.00
Z1176:Chil1 UTSW 1 134182779 critical splice acceptor site probably null
Z1176:Chil1 UTSW 1 134189230 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAATTTGCATGAAGCCAGCAGCC -3'
(R):5'- TGGAAATCATCCAAATCCAGTGCCC -3'

Sequencing Primer
(F):5'- AAGCCAGCAGCCTGGAG -3'
(R):5'- TTCAGGAACCCAACCTGGTG -3'
Posted On2014-01-29