Mutagenetix > Incidental Mutations

Incidental Mutation 'R1263:Mical3'

151654

Institutional Source

Beutler Lab

Gene Symbol

Mical3

Ensembl Gene

ENSMUSG00000051586

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 3

Synonyms

MICAL-3, C130040D16Rik

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120931707-121130999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120952469 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1812 (E1812G)

Ref Sequence

ENSEMBL: ENSMUSP00000146544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000098457

SMART Domains

Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
low complexity region	57	80	N/A	INTRINSIC
coiled coil region	114	148	N/A	INTRINSIC
low complexity region	191	225	N/A	INTRINSIC
coiled coil region	238	265	N/A	INTRINSIC
low complexity region	317	330	N/A	INTRINSIC
low complexity region	374	383	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	582	592	N/A	INTRINSIC
low complexity region	625	637	N/A	INTRINSIC
low complexity region	794	824	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
low complexity region	911	929	N/A	INTRINSIC
low complexity region	950	962	N/A	INTRINSIC
DUF3585	968	1110	1.39e-65	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151602

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205062

Predicted Effect

probably damaging
Transcript: ENSMUST00000207889
AA Change: E1812G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

unknown
Transcript: ENSMUST00000212333
AA Change: E940G

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Abca8b	A	C	11: 109,941,607	H1231Q	possibly damaging	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Col6a6	T	A	9: 105,709,489	M1778L	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Nrp1	T	A	8: 128,468,389	I442N	probably damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Shprh	A	G	10: 11,159,530	H327R	probably damaging	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tep1	C	A	14: 50,845,513	V1013L	possibly damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Tonsl	T	A	15: 76,622,562	I115F	possibly damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Mical3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Mical3	APN	6	120961624	missense	possibly damaging	0.73
IGL00718:Mical3	APN	6	121040449	missense	probably damaging	0.98
IGL00940:Mical3	APN	6	121022410	missense	possibly damaging	0.55
IGL00973:Mical3	APN	6	120934924	splice site	probably benign
IGL01503:Mical3	APN	6	120958576	missense	probably benign	0.09
IGL01991:Mical3	APN	6	120935211	missense	probably damaging	0.98
IGL02794:Mical3	APN	6	121007309	missense	probably damaging	0.99
IGL02996:Mical3	APN	6	120958558	missense	probably damaging	1.00
IGL03105:Mical3	APN	6	121042238	missense	probably benign	0.01
IGL03109:Mical3	APN	6	121009124	missense	probably damaging	1.00
IGL03236:Mical3	APN	6	120969384	missense	probably benign	0.00
P0028:Mical3	UTSW	6	121024689	missense	probably benign	0.33
R0244:Mical3	UTSW	6	120957722	missense	probably benign	0.00
R0494:Mical3	UTSW	6	120959201	missense	possibly damaging	0.94
R0586:Mical3	UTSW	6	121029641	unclassified	probably benign
R1029:Mical3	UTSW	6	120934678	missense	probably benign	0.02
R1507:Mical3	UTSW	6	121042238	missense	probably benign	0.36
R1527:Mical3	UTSW	6	121024779	missense	probably damaging	0.99
R1623:Mical3	UTSW	6	121024807	missense	probably damaging	0.99
R1680:Mical3	UTSW	6	120959643	missense	probably benign	0.09
R1697:Mical3	UTSW	6	121007408	missense	possibly damaging	0.84
R1817:Mical3	UTSW	6	121042235	missense	probably benign	0.06
R1875:Mical3	UTSW	6	121042064	missense	probably damaging	1.00
R1961:Mical3	UTSW	6	120982607	missense	possibly damaging	0.94
R2004:Mical3	UTSW	6	120951322	missense	probably damaging	1.00
R2093:Mical3	UTSW	6	121040386	missense	probably damaging	1.00
R2141:Mical3	UTSW	6	121031134	splice site	probably null
R2142:Mical3	UTSW	6	121031134	splice site	probably null
R2257:Mical3	UTSW	6	121033735	missense	possibly damaging	0.94
R2404:Mical3	UTSW	6	120959828	missense	probably benign	0.01
R2419:Mical3	UTSW	6	120959923	missense	probably benign
R2509:Mical3	UTSW	6	121034157	missense	probably damaging	1.00
R3784:Mical3	UTSW	6	121021337	missense	probably benign	0.00
R4342:Mical3	UTSW	6	120934838	nonsense	probably null
R4343:Mical3	UTSW	6	120934838	nonsense	probably null
R4579:Mical3	UTSW	6	120958699	missense	probably benign
R4603:Mical3	UTSW	6	120934838	nonsense	probably null
R4605:Mical3	UTSW	6	121034080	nonsense	probably null
R4610:Mical3	UTSW	6	120934838	nonsense	probably null
R4611:Mical3	UTSW	6	120934838	nonsense	probably null
R4623:Mical3	UTSW	6	120961625	nonsense	probably null
R4669:Mical3	UTSW	6	120957703	missense	probably damaging	0.98
R4704:Mical3	UTSW	6	120958688	missense	probably benign	0.00
R4722:Mical3	UTSW	6	121038525	missense	probably benign	0.00
R4863:Mical3	UTSW	6	121033787	missense	probably damaging	0.99
R4878:Mical3	UTSW	6	120969387	missense	possibly damaging	0.51
R4885:Mical3	UTSW	6	120935253	missense	probably damaging	1.00
R4907:Mical3	UTSW	6	121007298	missense	probably benign	0.00
R5007:Mical3	UTSW	6	121038069	missense	probably damaging	0.98
R5299:Mical3	UTSW	6	120959512	missense	possibly damaging	0.71
R5303:Mical3	UTSW	6	120959980	missense	probably benign
R5368:Mical3	UTSW	6	120959473	missense	probably damaging	1.00
R5955:Mical3	UTSW	6	121033750	missense	probably damaging	0.99
R5970:Mical3	UTSW	6	120958271	nonsense	probably null
R6000:Mical3	UTSW	6	121021320	missense	probably benign	0.06
R6101:Mical3	UTSW	6	121033710	missense	probably damaging	1.00
R6195:Mical3	UTSW	6	121016835	intron	probably benign
R6210:Mical3	UTSW	6	121040517	splice site	probably null
R6225:Mical3	UTSW	6	120958723	missense	probably damaging	0.98
R6258:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6260:Mical3	UTSW	6	121009030	missense	probably damaging	1.00
R6349:Mical3	UTSW	6	120959525	missense	probably benign
R6352:Mical3	UTSW	6	120952473	missense	probably damaging	0.97
R6480:Mical3	UTSW	6	121034275	missense	possibly damaging	0.76
R6704:Mical3	UTSW	6	121009800	intron	probably benign
R6783:Mical3	UTSW	6	120958825	missense	possibly damaging	0.85
R6925:Mical3	UTSW	6	120959390	missense	probably benign	0.05
R6960:Mical3	UTSW	6	120958543	missense	probably damaging	1.00
R7170:Mical3	UTSW	6	120973733	splice site	probably null
R7344:Mical3	UTSW	6	121036544	nonsense	probably null
R7414:Mical3	UTSW	6	121034113	missense	probably damaging	1.00
R7455:Mical3	UTSW	6	120958744	missense	probably damaging	1.00
R7649:Mical3	UTSW	6	120934948	missense	probably damaging	1.00
R8236:Mical3	UTSW	6	121012543	missense
R8286:Mical3	UTSW	6	121021188	missense	possibly damaging	0.68
R8316:Mical3	UTSW	6	120934983	missense	probably damaging	1.00
R8328:Mical3	UTSW	6	120935177	missense	probably damaging	0.98
R8354:Mical3	UTSW	6	120973420	missense	probably damaging	0.99
R8511:Mical3	UTSW	6	121038552	missense	possibly damaging	0.78
U24488:Mical3	UTSW	6	121001496	missense	possibly damaging	0.90
Z1177:Mical3	UTSW	6	120959728	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- GGAAGACAAGAACGCCCTATCTGC -3'
(R):5'- TGCCACAGAGGTAAAATGCCTCAC -3'

Sequencing Primer
(F):5'- AAGAACGCCCTATCTGCTTCTG -3'
(R):5'- AAATGCCTCACATTGGGGTC -3'

Posted On

2014-01-29