Incidental Mutation 'R1263:Mical3'
ID151654
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120952469 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1812 (E1812G)
Ref Sequence ENSEMBL: ENSMUSP00000146544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098457
SMART Domains Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
coiled coil region 114 148 N/A INTRINSIC
low complexity region 191 225 N/A INTRINSIC
coiled coil region 238 265 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 582 592 N/A INTRINSIC
low complexity region 625 637 N/A INTRINSIC
low complexity region 794 824 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
low complexity region 911 929 N/A INTRINSIC
low complexity region 950 962 N/A INTRINSIC
DUF3585 968 1110 1.39e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205062
Predicted Effect probably damaging
Transcript: ENSMUST00000207889
AA Change: E1812G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000212333
AA Change: E940G
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
R7170:Mical3 UTSW 6 120973733 intron probably null
R7344:Mical3 UTSW 6 121036544 nonsense probably null
R7414:Mical3 UTSW 6 121034113 missense probably damaging 1.00
R7455:Mical3 UTSW 6 120958744 missense probably damaging 1.00
R7649:Mical3 UTSW 6 120934948 missense probably damaging 1.00
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGAAGACAAGAACGCCCTATCTGC -3'
(R):5'- TGCCACAGAGGTAAAATGCCTCAC -3'

Sequencing Primer
(F):5'- AAGAACGCCCTATCTGCTTCTG -3'
(R):5'- AAATGCCTCACATTGGGGTC -3'
Posted On2014-01-29