Incidental Mutation 'R1263:Vmn2r26'
ID 151655
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 039330-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R1263 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124027667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 469 (I469N)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: I469N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: I469N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A C 11: 109,832,433 (GRCm39) H1231Q possibly damaging Het
Acbd4 T A 11: 102,994,677 (GRCm39) probably null Het
Atp13a4 T A 16: 29,290,771 (GRCm39) Y226F possibly damaging Het
Brd3 A C 2: 27,352,534 (GRCm39) F132C probably damaging Het
Btaf1 A T 19: 36,933,924 (GRCm39) N184I probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Ccdc185 A T 1: 182,574,918 (GRCm39) Y590* probably null Het
Chi3l1 G A 1: 134,116,980 (GRCm39) E315K probably benign Het
Col6a6 T A 9: 105,586,688 (GRCm39) M1778L probably benign Het
Cyp3a59 A C 5: 146,041,521 (GRCm39) Y355S probably damaging Het
Cyp4a31 A G 4: 115,431,908 (GRCm39) T396A probably benign Het
Dnaaf6rt A T 1: 31,262,296 (GRCm39) I93F probably damaging Het
Dnah6 A T 6: 73,121,948 (GRCm39) I1373N probably damaging Het
Dop1b C A 16: 93,574,274 (GRCm39) H1598N probably benign Het
Erich4 T A 7: 25,314,559 (GRCm39) K118M probably damaging Het
Gkap1 A T 13: 58,403,587 (GRCm39) V179E probably benign Het
Gpr107 T G 2: 31,068,267 (GRCm39) I243S possibly damaging Het
Hs3st6 A G 17: 24,977,504 (GRCm39) N328S probably damaging Het
Kcnq5 A T 1: 21,549,602 (GRCm39) I375N probably damaging Het
Klhdc3 A T 17: 46,987,892 (GRCm39) H266Q probably benign Het
Krt71 C T 15: 101,643,901 (GRCm39) G446R probably damaging Het
L3mbtl2 A G 15: 81,567,169 (GRCm39) T423A probably benign Het
Mical3 T C 6: 120,929,430 (GRCm39) E1812G probably damaging Het
Nlrp1a A G 11: 70,987,948 (GRCm39) I1174T probably benign Het
Npas2 C A 1: 39,373,849 (GRCm39) Q450K possibly damaging Het
Nrp1 T A 8: 129,194,870 (GRCm39) I442N probably damaging Het
Or1j10 T A 2: 36,267,006 (GRCm39) S73T probably damaging Het
Or2y1 A T 11: 49,385,848 (GRCm39) M163L probably benign Het
Palld TGCGTAGCG TGCG 8: 61,966,491 (GRCm39) probably null Het
Pold3 T A 7: 99,768,890 (GRCm39) Q36L possibly damaging Het
Polg T C 7: 79,109,534 (GRCm39) T428A probably benign Het
Rfx7 T A 9: 72,484,329 (GRCm39) V57E possibly damaging Het
Rnf122 T G 8: 31,602,177 (GRCm39) M1R probably null Het
Sanbr A T 11: 23,570,278 (GRCm39) Y207* probably null Het
Scn10a T A 9: 119,446,799 (GRCm39) T1410S probably damaging Het
Serpinb13 T A 1: 106,928,466 (GRCm39) V362E probably damaging Het
Setdb1 T C 3: 95,234,922 (GRCm39) N927S probably damaging Het
Sft2d1 A G 17: 8,539,470 (GRCm39) K91R probably benign Het
Shprh A G 10: 11,035,274 (GRCm39) H327R probably damaging Het
Slc9b2 C A 3: 135,042,156 (GRCm39) H478Q probably benign Het
Styxl1 G T 5: 135,782,737 (GRCm39) S117R probably damaging Het
Synj2 T C 17: 6,069,634 (GRCm39) F150L probably damaging Het
Tep1 C A 14: 51,082,970 (GRCm39) V1013L possibly damaging Het
Tgfbi T A 13: 56,778,468 (GRCm39) L413Q probably damaging Het
Tmc5 G A 7: 118,266,093 (GRCm39) R789Q probably damaging Het
Tonsl T A 15: 76,506,762 (GRCm39) I115F possibly damaging Het
Trim38 A G 13: 23,975,117 (GRCm39) Y352C probably damaging Het
Txnl4a T A 18: 80,250,536 (GRCm39) V44D probably benign Het
Vars2 A G 17: 35,972,501 (GRCm39) V39A probably damaging Het
Vmn2r105 A G 17: 20,428,584 (GRCm39) C831R probably damaging Het
Vmn2r53 T C 7: 12,315,533 (GRCm39) Y762C probably benign Het
Vps13d T A 4: 144,896,918 (GRCm39) Q334L probably benign Het
Zfp277 A T 12: 40,414,164 (GRCm39) I227N probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCCAGAGTCCTTCTTTCATCACTG -3'
(R):5'- ACTCTCAGCCTGATGGCACTTAGC -3'

Sequencing Primer
(F):5'- gcaataatgaaacctgcaaggac -3'
(R):5'- TGGCACTTAGCAGTCATCTGAAC -3'
Posted On 2014-01-29