Mutagenetix > Incidental Mutations

Incidental Mutation 'R1263:Nrp1'

151664

Institutional Source

Beutler Lab

Gene Symbol

Nrp1

Ensembl Gene

ENSMUSG00000025810

Gene Name

neuropilin 1

Synonyms

Neuropilin-1, NP-1, NPN-1, Npn1

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128358604-128503363 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128468389 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 442 (I442N)

Ref Sequence

ENSEMBL: ENSMUSP00000026917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026917]

PDB Structure

Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026917
AA Change: I442N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: I442N

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CUB	27	141	1.44e-43	SMART
CUB	147	265	9.19e-42	SMART
FA58C	274	424	5.21e-44	SMART
FA58C	430	583	4.15e-20	SMART
low complexity region	587	599	N/A	INTRINSIC
MAM	645	811	4.94e-69	SMART
Pfam:DUF3481	837	920	3.5e-31	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Abca8b	A	C	11: 109,941,607	H1231Q	possibly damaging	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Col6a6	T	A	9: 105,709,489	M1778L	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Mical3	T	C	6: 120,952,469	E1812G	probably damaging	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Shprh	A	G	10: 11,159,530	H327R	probably damaging	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tep1	C	A	14: 50,845,513	V1013L	possibly damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Tonsl	T	A	15: 76,622,562	I115F	possibly damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Nrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrp1	APN	8	128476207	missense	probably benign
IGL01412:Nrp1	APN	8	128418707	splice site	probably benign
IGL01586:Nrp1	APN	8	128432032	missense	possibly damaging	0.86
IGL02307:Nrp1	APN	8	128502720	missense	probably damaging	1.00
IGL02500:Nrp1	APN	8	128425799	missense	possibly damaging	0.94
IGL02547:Nrp1	APN	8	128493031	missense	probably benign
R0046:Nrp1	UTSW	8	128500608	splice site	probably benign
R0281:Nrp1	UTSW	8	128460683	missense	probably damaging	0.96
R0403:Nrp1	UTSW	8	128457969	missense	probably damaging	1.00
R0610:Nrp1	UTSW	8	128502618	missense	probably damaging	1.00
R1055:Nrp1	UTSW	8	128468598	missense	possibly damaging	0.68
R1229:Nrp1	UTSW	8	128418716	nonsense	probably null
R1340:Nrp1	UTSW	8	128434355	missense	probably damaging	1.00
R1397:Nrp1	UTSW	8	128418716	nonsense	probably null
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1531:Nrp1	UTSW	8	128425969	missense	probably null	0.19
R1587:Nrp1	UTSW	8	128476282	missense	probably damaging	1.00
R1719:Nrp1	UTSW	8	128425885	missense	probably damaging	1.00
R1733:Nrp1	UTSW	8	128468493	missense	probably benign	0.02
R1785:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R1786:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2047:Nrp1	UTSW	8	128498096	splice site	probably benign
R2130:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2132:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2133:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2163:Nrp1	UTSW	8	128497871	missense	probably damaging	1.00
R2338:Nrp1	UTSW	8	128497904	missense	probably benign	0.01
R2407:Nrp1	UTSW	8	128431945	missense	probably damaging	0.99
R3405:Nrp1	UTSW	8	128498088	nonsense	probably null
R3748:Nrp1	UTSW	8	128457980	missense	probably damaging	1.00
R4347:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R4379:Nrp1	UTSW	8	128468467	missense	probably damaging	1.00
R4646:Nrp1	UTSW	8	128457944	missense	probably benign	0.00
R4688:Nrp1	UTSW	8	128502566	missense	probably benign	0.01
R4916:Nrp1	UTSW	8	128502804	nonsense	probably null
R5077:Nrp1	UTSW	8	128500673	critical splice donor site	probably null
R5301:Nrp1	UTSW	8	128434197	splice site	probably null
R5509:Nrp1	UTSW	8	128425915	missense	possibly damaging	0.73
R5745:Nrp1	UTSW	8	128468448	missense	probably benign	0.22
R5873:Nrp1	UTSW	8	128468377	missense	probably damaging	1.00
R5987:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
R6060:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
R6757:Nrp1	UTSW	8	128425868	missense	probably damaging	1.00
R6889:Nrp1	UTSW	8	128493057	missense	probably damaging	1.00
R7025:Nrp1	UTSW	8	128480954	missense	probably damaging	1.00
R7065:Nrp1	UTSW	8	128460712	missense	probably benign
R7290:Nrp1	UTSW	8	128476296	critical splice donor site	probably null
R7369:Nrp1	UTSW	8	128431915	missense	probably damaging	1.00
R7553:Nrp1	UTSW	8	128431987	missense	probably damaging	1.00
R7650:Nrp1	UTSW	8	128498014	missense	possibly damaging	0.87
R8043:Nrp1	UTSW	8	128432023	missense	probably benign	0.00
X0066:Nrp1	UTSW	8	128460645	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ATGCTGAGCCAGGCTCTTCCTTTG -3'
(R):5'- GCTTCCCACCCTGAATGATGACAC -3'

Sequencing Primer
(F):5'- CTTCTCCTTGAAATGGGAGCAAC -3'
(R):5'- CCCTGAATGATGACACCTCTTAC -3'

Posted On

2014-01-29