Incidental Mutation 'R1263:Col6a6'
ID 151666
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 039330-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1263 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 105566616-105705413 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105586688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1778 (M1778L)
Ref Sequence ENSEMBL: ENSMUSP00000125765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect probably benign
Transcript: ENSMUST00000098441
AA Change: M1778L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: M1778L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
AA Change: M1778L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: M1778L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A C 11: 109,832,433 (GRCm39) H1231Q possibly damaging Het
Acbd4 T A 11: 102,994,677 (GRCm39) probably null Het
Atp13a4 T A 16: 29,290,771 (GRCm39) Y226F possibly damaging Het
Brd3 A C 2: 27,352,534 (GRCm39) F132C probably damaging Het
Btaf1 A T 19: 36,933,924 (GRCm39) N184I probably benign Het
Ccdc180 A G 4: 45,903,887 (GRCm39) E351G possibly damaging Het
Ccdc185 A T 1: 182,574,918 (GRCm39) Y590* probably null Het
Chi3l1 G A 1: 134,116,980 (GRCm39) E315K probably benign Het
Cyp3a59 A C 5: 146,041,521 (GRCm39) Y355S probably damaging Het
Cyp4a31 A G 4: 115,431,908 (GRCm39) T396A probably benign Het
Dnaaf6rt A T 1: 31,262,296 (GRCm39) I93F probably damaging Het
Dnah6 A T 6: 73,121,948 (GRCm39) I1373N probably damaging Het
Dop1b C A 16: 93,574,274 (GRCm39) H1598N probably benign Het
Erich4 T A 7: 25,314,559 (GRCm39) K118M probably damaging Het
Gkap1 A T 13: 58,403,587 (GRCm39) V179E probably benign Het
Gpr107 T G 2: 31,068,267 (GRCm39) I243S possibly damaging Het
Hs3st6 A G 17: 24,977,504 (GRCm39) N328S probably damaging Het
Kcnq5 A T 1: 21,549,602 (GRCm39) I375N probably damaging Het
Klhdc3 A T 17: 46,987,892 (GRCm39) H266Q probably benign Het
Krt71 C T 15: 101,643,901 (GRCm39) G446R probably damaging Het
L3mbtl2 A G 15: 81,567,169 (GRCm39) T423A probably benign Het
Mical3 T C 6: 120,929,430 (GRCm39) E1812G probably damaging Het
Nlrp1a A G 11: 70,987,948 (GRCm39) I1174T probably benign Het
Npas2 C A 1: 39,373,849 (GRCm39) Q450K possibly damaging Het
Nrp1 T A 8: 129,194,870 (GRCm39) I442N probably damaging Het
Or1j10 T A 2: 36,267,006 (GRCm39) S73T probably damaging Het
Or2y1 A T 11: 49,385,848 (GRCm39) M163L probably benign Het
Palld TGCGTAGCG TGCG 8: 61,966,491 (GRCm39) probably null Het
Pold3 T A 7: 99,768,890 (GRCm39) Q36L possibly damaging Het
Polg T C 7: 79,109,534 (GRCm39) T428A probably benign Het
Rfx7 T A 9: 72,484,329 (GRCm39) V57E possibly damaging Het
Rnf122 T G 8: 31,602,177 (GRCm39) M1R probably null Het
Sanbr A T 11: 23,570,278 (GRCm39) Y207* probably null Het
Scn10a T A 9: 119,446,799 (GRCm39) T1410S probably damaging Het
Serpinb13 T A 1: 106,928,466 (GRCm39) V362E probably damaging Het
Setdb1 T C 3: 95,234,922 (GRCm39) N927S probably damaging Het
Sft2d1 A G 17: 8,539,470 (GRCm39) K91R probably benign Het
Shprh A G 10: 11,035,274 (GRCm39) H327R probably damaging Het
Slc9b2 C A 3: 135,042,156 (GRCm39) H478Q probably benign Het
Styxl1 G T 5: 135,782,737 (GRCm39) S117R probably damaging Het
Synj2 T C 17: 6,069,634 (GRCm39) F150L probably damaging Het
Tep1 C A 14: 51,082,970 (GRCm39) V1013L possibly damaging Het
Tgfbi T A 13: 56,778,468 (GRCm39) L413Q probably damaging Het
Tmc5 G A 7: 118,266,093 (GRCm39) R789Q probably damaging Het
Tonsl T A 15: 76,506,762 (GRCm39) I115F possibly damaging Het
Trim38 A G 13: 23,975,117 (GRCm39) Y352C probably damaging Het
Txnl4a T A 18: 80,250,536 (GRCm39) V44D probably benign Het
Vars2 A G 17: 35,972,501 (GRCm39) V39A probably damaging Het
Vmn2r105 A G 17: 20,428,584 (GRCm39) C831R probably damaging Het
Vmn2r26 T A 6: 124,027,667 (GRCm39) I469N probably benign Het
Vmn2r53 T C 7: 12,315,533 (GRCm39) Y762C probably benign Het
Vps13d T A 4: 144,896,918 (GRCm39) Q334L probably benign Het
Zfp277 A T 12: 40,414,164 (GRCm39) I227N probably damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105,635,390 (GRCm39) critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105,659,611 (GRCm39) missense probably benign 0.04
IGL00917:Col6a6 APN 9 105,661,453 (GRCm39) splice site probably benign
IGL01385:Col6a6 APN 9 105,660,865 (GRCm39) missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105,663,157 (GRCm39) nonsense probably null
IGL01508:Col6a6 APN 9 105,604,365 (GRCm39) splice site probably benign
IGL01668:Col6a6 APN 9 105,586,470 (GRCm39) missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105,586,454 (GRCm39) missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105,566,825 (GRCm39) missense probably benign 0.02
IGL01934:Col6a6 APN 9 105,575,858 (GRCm39) critical splice donor site probably null
IGL01944:Col6a6 APN 9 105,661,108 (GRCm39) missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105,658,184 (GRCm39) missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105,644,398 (GRCm39) critical splice donor site probably null
IGL02129:Col6a6 APN 9 105,613,539 (GRCm39) splice site probably benign
IGL02201:Col6a6 APN 9 105,658,194 (GRCm39) missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105,661,300 (GRCm39) missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105,609,415 (GRCm39) missense probably benign 0.05
IGL02574:Col6a6 APN 9 105,659,390 (GRCm39) missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105,604,369 (GRCm39) critical splice donor site probably null
IGL02852:Col6a6 APN 9 105,661,272 (GRCm39) missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105,586,651 (GRCm39) missense probably benign 0.01
IGL03327:Col6a6 APN 9 105,644,433 (GRCm39) missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105,609,462 (GRCm39) missense probably benign 0.23
R0042:Col6a6 UTSW 9 105,657,896 (GRCm39) missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105,626,047 (GRCm39) splice site probably benign
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105,579,474 (GRCm39) missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105,644,487 (GRCm39) missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105,661,315 (GRCm39) missense probably benign 0.13
R0382:Col6a6 UTSW 9 105,632,754 (GRCm39) missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105,661,403 (GRCm39) missense probably benign 0.02
R0421:Col6a6 UTSW 9 105,661,405 (GRCm39) missense probably benign 0.02
R0502:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0503:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0600:Col6a6 UTSW 9 105,638,639 (GRCm39) missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105,654,943 (GRCm39) missense probably benign 0.45
R0629:Col6a6 UTSW 9 105,604,364 (GRCm39) splice site probably benign
R0690:Col6a6 UTSW 9 105,586,685 (GRCm39) missense probably benign 0.01
R1155:Col6a6 UTSW 9 105,659,289 (GRCm39) missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105,626,109 (GRCm39) missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105,651,502 (GRCm39) missense probably null 0.98
R1296:Col6a6 UTSW 9 105,658,290 (GRCm39) missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105,586,672 (GRCm39) missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105,655,274 (GRCm39) missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105,654,748 (GRCm39) missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105,609,410 (GRCm39) critical splice donor site probably null
R1830:Col6a6 UTSW 9 105,579,469 (GRCm39) missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105,658,301 (GRCm39) missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105,586,583 (GRCm39) missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105,658,003 (GRCm39) missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105,631,422 (GRCm39) missense probably benign 0.01
R3176:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3276:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3429:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105,659,373 (GRCm39) missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105,657,891 (GRCm39) missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105,576,078 (GRCm39) missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105,661,155 (GRCm39) missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105,660,889 (GRCm39) missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105,576,148 (GRCm39) missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105,644,541 (GRCm39) missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105,644,623 (GRCm39) missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105,666,147 (GRCm39) missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R5002:Col6a6 UTSW 9 105,663,292 (GRCm39) missense probably benign 0.00
R5111:Col6a6 UTSW 9 105,586,673 (GRCm39) missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105,659,232 (GRCm39) missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105,586,306 (GRCm39) missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105,651,537 (GRCm39) missense probably null 0.79
R5491:Col6a6 UTSW 9 105,615,435 (GRCm39) missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105,638,717 (GRCm39) critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105,644,274 (GRCm39) missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105,661,116 (GRCm39) missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105,604,426 (GRCm39) splice site probably null
R6425:Col6a6 UTSW 9 105,576,064 (GRCm39) missense probably benign 0.21
R6464:Col6a6 UTSW 9 105,666,152 (GRCm39) start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105,575,890 (GRCm39) missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105,663,024 (GRCm39) missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105,576,112 (GRCm39) missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105,660,879 (GRCm39) missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105,661,140 (GRCm39) missense probably benign 0.32
R7032:Col6a6 UTSW 9 105,644,707 (GRCm39) missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105,661,168 (GRCm39) missense probably benign 0.00
R7472:Col6a6 UTSW 9 105,659,622 (GRCm39) missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105,644,523 (GRCm39) missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R7716:Col6a6 UTSW 9 105,661,102 (GRCm39) missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105,566,760 (GRCm39) missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105,657,883 (GRCm39) nonsense probably null
R8016:Col6a6 UTSW 9 105,644,727 (GRCm39) missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105,576,219 (GRCm39) missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105,659,146 (GRCm39) missense probably benign 0.01
R8082:Col6a6 UTSW 9 105,661,129 (GRCm39) nonsense probably null
R8243:Col6a6 UTSW 9 105,576,468 (GRCm39) missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105,661,272 (GRCm39) missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105,632,853 (GRCm39) missense probably benign 0.25
R8384:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105,651,995 (GRCm39) missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105,651,987 (GRCm39) missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105,663,348 (GRCm39) missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105,644,528 (GRCm39) missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105,586,745 (GRCm39) missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105,661,276 (GRCm39) missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105,659,169 (GRCm39) missense probably benign 0.30
R9225:Col6a6 UTSW 9 105,659,437 (GRCm39) missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105,651,757 (GRCm39) missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105,663,172 (GRCm39) missense probably benign 0.00
R9360:Col6a6 UTSW 9 105,644,686 (GRCm39) missense probably benign 0.00
R9368:Col6a6 UTSW 9 105,663,300 (GRCm39) missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105,651,825 (GRCm39) missense probably benign 0.40
R9450:Col6a6 UTSW 9 105,661,373 (GRCm39) missense probably benign
R9454:Col6a6 UTSW 9 105,661,059 (GRCm39) missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105,586,361 (GRCm39) missense probably benign 0.01
R9563:Col6a6 UTSW 9 105,572,952 (GRCm39) missense probably benign 0.02
R9568:Col6a6 UTSW 9 105,657,926 (GRCm39) missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105,616,401 (GRCm39) missense probably benign 0.07
R9664:Col6a6 UTSW 9 105,658,254 (GRCm39) missense probably benign 0.11
R9747:Col6a6 UTSW 9 105,661,239 (GRCm39) missense probably benign 0.29
R9760:Col6a6 UTSW 9 105,659,253 (GRCm39) missense probably damaging 0.99
X0022:Col6a6 UTSW 9 105,576,531 (GRCm39) missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105,658,151 (GRCm39) missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105,666,094 (GRCm39) missense probably null 0.24
Z1177:Col6a6 UTSW 9 105,605,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCGGAGGATCTCTCATAAGG -3'
(R):5'- AGTACAGATGCGAATGACCATGCC -3'

Sequencing Primer
(F):5'- GAGGATCTCTCATAAGGAAGAGC -3'
(R):5'- CGAATGACCATGCCTTTGAG -3'
Posted On 2014-01-29