Mutagenetix > Incidental Mutations

Incidental Mutation 'R1263:Col6a6'

151666

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105709489 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1778 (M1778L)

Ref Sequence

ENSEMBL: ENSMUSP00000125765 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]

Predicted Effect

probably benign
Transcript: ENSMUST00000098441
AA Change: M1778L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: M1778L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166431
AA Change: M1778L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: M1778L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Abca8b	A	C	11: 109,941,607	H1231Q	possibly damaging	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Mical3	T	C	6: 120,952,469	E1812G	probably damaging	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Nrp1	T	A	8: 128,468,389	I442N	probably damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Shprh	A	G	10: 11,159,530	H327R	probably damaging	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tep1	C	A	14: 50,845,513	V1013L	possibly damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Tonsl	T	A	15: 76,622,562	I115F	possibly damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R7938:Col6a6	UTSW	9	105780684	nonsense	probably null
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
R8324:Col6a6	UTSW	9	105755654	missense	probably benign	0.25
R8384:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R8400:Col6a6	UTSW	9	105774796	missense	probably damaging	1.00
R8523:Col6a6	UTSW	9	105774788	missense	possibly damaging	0.71
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- TGCTGTCGGAGGATCTCTCATAAGG -3'
(R):5'- AGTACAGATGCGAATGACCATGCC -3'

Sequencing Primer
(F):5'- GAGGATCTCTCATAAGGAAGAGC -3'
(R):5'- CGAATGACCATGCCTTTGAG -3'

Posted On

2014-01-29