Mutagenetix > Incidental Mutations

Incidental Mutation 'R1263:Shprh'

151668

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11159530 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 327 (H327R)

Ref Sequence

ENSEMBL: ENSMUSP00000125457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044053
AA Change: H327R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: H327R

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000054814
AA Change: H327R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: H327R

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159541
AA Change: H327R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: H327R

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159810
AA Change: H327R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: H327R

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160461

SMART Domains

Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

Domain	Start	End	E-Value	Type
PHD	131	178	2.33e-5	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Abca8b	A	C	11: 109,941,607	H1231Q	possibly damaging	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Col6a6	T	A	9: 105,709,489	M1778L	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Mical3	T	C	6: 120,952,469	E1812G	probably damaging	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Nrp1	T	A	8: 128,468,389	I442N	probably damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tep1	C	A	14: 50,845,513	V1013L	possibly damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Tonsl	T	A	15: 76,622,562	I115F	possibly damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0325:Shprh	UTSW	10	11170109	missense	probably benign	0.00
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1638:Shprh	UTSW	10	11157078	missense	probably benign
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	synonymous	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R5872:Shprh	UTSW	10	11188073	missense	probably damaging	1.00
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7158:Shprh	UTSW	10	11166730	missense	probably damaging	0.98
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCTGTGGCATTTCCCAAATGAGC -3'
(R):5'- GAAGGCAGGATTTTCCCTCTATGGTC -3'

Sequencing Primer
(F):5'- ATGAGCCTTCCCAAGGATGTG -3'
(R):5'- ctaatctctcctttactctctagctc -3'

Posted On

2014-01-29