Incidental Mutation 'R1263:Nlrp1a'
ID151671
Institutional Source Beutler Lab
Gene Symbol Nlrp1a
Ensembl Gene ENSMUSG00000069830
Gene NameNLR family, pyrin domain containing 1A
SynonymsNalp1
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71092236-71144704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71097122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1174 (I1174T)
Ref Sequence ENSEMBL: ENSMUSP00000038186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048514] [ENSMUST00000108518]
Predicted Effect probably benign
Transcript: ENSMUST00000048514
AA Change: I1174T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038186
Gene: ENSMUSG00000069830
AA Change: I1174T

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 4.6e-41 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 742 769 3.04e-5 SMART
low complexity region 856 870 N/A INTRINSIC
Pfam:FIIND 921 1173 1.6e-102 PFAM
Pfam:CARD 1209 1292 2.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108518
SMART Domains Protein: ENSMUSP00000104158
Gene: ENSMUSG00000069830

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 1.1e-40 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 661 688 2.85e1 SMART
LRR 689 716 3.04e-5 SMART
Pfam:FIIND 819 1073 3e-136 PFAM
Pfam:CARD 1091 1174 8.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Nlrp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Nlrp1a APN 11 71092957 missense probably benign 0.00
IGL00771:Nlrp1a APN 11 71122741 nonsense probably null
IGL01408:Nlrp1a APN 11 71122916 missense probably benign 0.04
IGL01886:Nlrp1a APN 11 71123501 missense probably benign
IGL02221:Nlrp1a APN 11 71123118 missense possibly damaging 0.88
IGL02291:Nlrp1a APN 11 71122589 critical splice donor site probably null
IGL02375:Nlrp1a APN 11 71113513 nonsense probably null
IGL02408:Nlrp1a APN 11 71122630 missense probably benign 0.00
IGL02516:Nlrp1a APN 11 71114460 missense probably damaging 1.00
IGL02583:Nlrp1a APN 11 71123401 missense probably benign 0.03
IGL02622:Nlrp1a APN 11 71123000 missense possibly damaging 0.88
IGL02642:Nlrp1a APN 11 71123532 missense probably benign 0.12
IGL02823:Nlrp1a APN 11 71092423 missense probably damaging 0.96
IGL02859:Nlrp1a APN 11 71106086 missense possibly damaging 0.57
IGL02997:Nlrp1a APN 11 71123665 missense probably damaging 1.00
IGL03342:Nlrp1a APN 11 71122791 missense probably benign 0.19
Ants UTSW 11 71142338 missense probably benign 0.01
dreary UTSW 11 71113640 critical splice acceptor site probably null
picnic UTSW 11 71122747 missense possibly damaging 0.87
seedless UTSW 11 71123552 missense probably benign 0.44
watermelon UTSW 11 71122705 missense probably benign 0.08
R0022:Nlrp1a UTSW 11 71123381 missense probably damaging 0.99
R0345:Nlrp1a UTSW 11 71123675 missense probably damaging 1.00
R0360:Nlrp1a UTSW 11 71114004 intron probably benign
R0364:Nlrp1a UTSW 11 71114004 intron probably benign
R0566:Nlrp1a UTSW 11 71122942 missense probably benign 0.00
R1177:Nlrp1a UTSW 11 71107721 missense probably damaging 1.00
R1240:Nlrp1a UTSW 11 71113466 critical splice donor site probably null
R1681:Nlrp1a UTSW 11 71142358 missense unknown
R1743:Nlrp1a UTSW 11 71124206 missense probably benign 0.04
R1826:Nlrp1a UTSW 11 71107980 intron probably benign
R1826:Nlrp1a UTSW 11 71122747 missense possibly damaging 0.87
R1981:Nlrp1a UTSW 11 71098938 missense probably damaging 1.00
R2083:Nlrp1a UTSW 11 71124220 missense possibly damaging 0.59
R2116:Nlrp1a UTSW 11 71114500 nonsense probably null
R2134:Nlrp1a UTSW 11 71124188 missense probably benign 0.00
R2148:Nlrp1a UTSW 11 71122907 nonsense probably null
R2301:Nlrp1a UTSW 11 71106101 missense possibly damaging 0.94
R3029:Nlrp1a UTSW 11 71123630 missense probably damaging 1.00
R3113:Nlrp1a UTSW 11 71123665 missense probably damaging 1.00
R3801:Nlrp1a UTSW 11 71122703 missense probably benign 0.08
R3898:Nlrp1a UTSW 11 71122874 missense probably benign 0.00
R4254:Nlrp1a UTSW 11 71123028 nonsense probably null
R4397:Nlrp1a UTSW 11 71097204 missense probably benign 0.00
R4647:Nlrp1a UTSW 11 71097126 splice site probably null
R4740:Nlrp1a UTSW 11 71113640 critical splice acceptor site probably null
R4965:Nlrp1a UTSW 11 71092315 missense possibly damaging 0.94
R5009:Nlrp1a UTSW 11 71122705 missense probably benign 0.08
R5103:Nlrp1a UTSW 11 71099526 missense probably damaging 0.99
R5355:Nlrp1a UTSW 11 71124251 missense probably benign 0.00
R5577:Nlrp1a UTSW 11 71099574 missense probably damaging 1.00
R5892:Nlrp1a UTSW 11 71099645 missense probably damaging 1.00
R5949:Nlrp1a UTSW 11 71098989 missense probably damaging 1.00
R5964:Nlrp1a UTSW 11 71123020 missense probably benign 0.00
R6220:Nlrp1a UTSW 11 71142338 missense probably benign 0.01
R6564:Nlrp1a UTSW 11 71123572 missense probably damaging 1.00
R6586:Nlrp1a UTSW 11 71106073 missense probably benign 0.00
R6925:Nlrp1a UTSW 11 71092513 missense probably null 0.99
R7013:Nlrp1a UTSW 11 71123552 missense probably benign 0.44
R7155:Nlrp1a UTSW 11 71124079 missense possibly damaging 0.93
R7214:Nlrp1a UTSW 11 71123293 missense probably damaging 1.00
R7268:Nlrp1a UTSW 11 71124242 missense probably benign 0.00
R7388:Nlrp1a UTSW 11 71123197 missense probably damaging 1.00
R7404:Nlrp1a UTSW 11 71097093 nonsense probably null
R7409:Nlrp1a UTSW 11 71122808 missense probably benign 0.03
R7410:Nlrp1a UTSW 11 71123857 missense probably damaging 0.99
R7440:Nlrp1a UTSW 11 71092324 missense probably damaging 0.99
R7447:Nlrp1a UTSW 11 71092411 missense probably damaging 1.00
R7450:Nlrp1a UTSW 11 71107658 missense probably damaging 1.00
R7569:Nlrp1a UTSW 11 71109043 missense probably benign 0.00
R7600:Nlrp1a UTSW 11 71098914 missense probably damaging 0.96
R7634:Nlrp1a UTSW 11 71099528 missense probably benign 0.19
R7734:Nlrp1a UTSW 11 71108000 missense unknown
R7747:Nlrp1a UTSW 11 71123408 missense possibly damaging 0.85
X0026:Nlrp1a UTSW 11 71142316 missense probably benign 0.18
Z1177:Nlrp1a UTSW 11 71123169 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCCAGCATTGTGAAGAACTGAATAACAG -3'
(R):5'- ACAGTCAGTGTCTAATGTGATGTGCAAG -3'

Sequencing Primer
(F):5'- CAGTGTCATAGTTCAAAGTGGG -3'
(R):5'- ctctctctctctctctctctctc -3'
Posted On2014-01-29