Mutagenetix > Incidental Mutations

Incidental Mutation 'R1263:Abca8b'

151672

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 109941607 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1231 (H1231Q)

Ref Sequence

ENSEMBL: ENSMUSP00000102280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

Predicted Effect

probably benign
Transcript: ENSMUST00000020948
AA Change: H1293Q

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: H1293Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106669
AA Change: H1231Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: H1231Q

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149226

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Col6a6	T	A	9: 105,709,489	M1778L	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Mical3	T	C	6: 120,952,469	E1812G	probably damaging	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Nrp1	T	A	8: 128,468,389	I442N	probably damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Shprh	A	G	10: 11,159,530	H327R	probably damaging	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tep1	C	A	14: 50,845,513	V1013L	possibly damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Tonsl	T	A	15: 76,622,562	I115F	possibly damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCCTTCAGTAAATACTGCTACATCCCC -3'
(R):5'- GCACACTGTCTGGTGCTTTTCG -3'

Sequencing Primer
(F):5'- TAAAGGAGCTGTCAGGCTACC -3'
(R):5'- TACTTTCCGTAGACAAGGGC -3'

Posted On

2014-01-29