Incidental Mutation 'R1263:Zfp277'
ID151673
Institutional Source Beutler Lab
Gene Symbol Zfp277
Ensembl Gene ENSMUSG00000055917
Gene Namezinc finger protein 277
Synonyms2410017E24Rik, NIRF4
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location40315046-40445902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40364165 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 227 (I227N)
Ref Sequence ENSEMBL: ENSMUSP00000064226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069637] [ENSMUST00000069692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069637
AA Change: I101N

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068032
Gene: ENSMUSG00000055917
AA Change: I101N

DomainStartEndE-ValueType
ZnF_C2H2 59 84 4.27e1 SMART
coiled coil region 143 171 N/A INTRINSIC
ZnF_C2H2 174 198 3.85e1 SMART
ZnF_C2H2 225 249 2.24e-3 SMART
low complexity region 280 292 N/A INTRINSIC
ZnF_C2H2 303 326 1.91e1 SMART
ZnF_C2H2 356 382 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069692
AA Change: I227N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064226
Gene: ENSMUSG00000055917
AA Change: I227N

DomainStartEndE-ValueType
ZnF_C2H2 185 210 4.27e1 SMART
coiled coil region 269 297 N/A INTRINSIC
ZnF_C2H2 300 324 3.85e1 SMART
ZnF_C2H2 351 375 2.24e-3 SMART
low complexity region 406 418 N/A INTRINSIC
ZnF_C2H2 429 452 1.91e1 SMART
ZnF_C2H2 482 508 4.94e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221847
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early cellular preplicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Other mutations in Zfp277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Zfp277 APN 12 40378826 missense probably benign 0.24
IGL01477:Zfp277 APN 12 40320676 missense probably benign 0.00
IGL02081:Zfp277 APN 12 40328796 nonsense probably null
IGL02165:Zfp277 APN 12 40315803 missense possibly damaging 0.75
IGL02613:Zfp277 APN 12 40329515 missense probably damaging 1.00
IGL02688:Zfp277 APN 12 40328688 missense possibly damaging 0.95
IGL02825:Zfp277 APN 12 40317176 missense probably benign 0.06
R0194:Zfp277 UTSW 12 40378877 splice site probably benign
R0226:Zfp277 UTSW 12 40364162 missense possibly damaging 0.67
R0843:Zfp277 UTSW 12 40320600 critical splice donor site probably null
R1584:Zfp277 UTSW 12 40378826 missense probably benign 0.12
R1609:Zfp277 UTSW 12 40328720 missense probably damaging 0.99
R1644:Zfp277 UTSW 12 40329610 splice site probably null
R1789:Zfp277 UTSW 12 40364085 missense probably benign 0.00
R1882:Zfp277 UTSW 12 40445746 missense probably benign 0.03
R2011:Zfp277 UTSW 12 40317218 nonsense probably null
R4884:Zfp277 UTSW 12 40363153 missense probably damaging 0.97
R4976:Zfp277 UTSW 12 40328688 missense possibly damaging 0.95
R5119:Zfp277 UTSW 12 40328688 missense possibly damaging 0.95
R5532:Zfp277 UTSW 12 40335309 missense probably damaging 1.00
R6340:Zfp277 UTSW 12 40318549 missense possibly damaging 0.57
R7191:Zfp277 UTSW 12 40329562 missense probably damaging 1.00
R7378:Zfp277 UTSW 12 40315853 missense possibly damaging 0.94
R7446:Zfp277 UTSW 12 40328730 missense probably damaging 1.00
R7564:Zfp277 UTSW 12 40329595 missense probably damaging 0.99
R7861:Zfp277 UTSW 12 40315881 missense possibly damaging 0.92
R7944:Zfp277 UTSW 12 40315881 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCAGCAATCATGCAATGAGAGCAAGT -3'
(R):5'- CCCCTAATTCCTGCGCTTTAAATGCTTA -3'

Sequencing Primer
(F):5'- CAATGAGAGCAAGTGCAATTTAAGAG -3'
(R):5'- gaaggtagagggtgaaaaatcag -3'
Posted On2014-01-29