Mutagenetix > Incidental Mutation

Incidental Mutation 'R1263:Tep1'

151677

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 50845513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1013 (V1013L)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

AlphaFold

P97499

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006444
AA Change: V1013L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: V1013L

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000226430
AA Change: V288L

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Abca8b	A	C	11: 109,941,607	H1231Q	possibly damaging	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Col6a6	T	A	9: 105,709,489	M1778L	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Mical3	T	C	6: 120,952,469	E1812G	probably damaging	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Nrp1	T	A	8: 128,468,389	I442N	probably damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Shprh	A	G	10: 11,159,530	H327R	probably damaging	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Tonsl	T	A	15: 76,622,562	I115F	possibly damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
R0240_Tep1_347	UTSW	14	50863029	splice site	probably benign
R0972_Tep1_893	UTSW	14	50824296	unclassified	probably benign
R1686_Tep1_375	UTSW	14	50836788	missense	probably benign	0.12
R7232_Tep1_671	UTSW	14	50844332	missense	unknown
R8009_Tep1_822	UTSW	14	50824230	missense	possibly damaging	0.93
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
R8475:Tep1	UTSW	14	50841255	missense	probably damaging	1.00
R8695:Tep1	UTSW	14	50845437	missense	possibly damaging	0.85
R8726:Tep1	UTSW	14	50847623	missense	probably damaging	0.98
R8812:Tep1	UTSW	14	50837132	missense	probably damaging	0.98
R9152:Tep1	UTSW	14	50866705	missense	probably benign	0.14
R9269:Tep1	UTSW	14	50844309	missense	probably damaging	0.98
R9365:Tep1	UTSW	14	50827140	missense	probably damaging	1.00
R9398:Tep1	UTSW	14	50828972	missense	possibly damaging	0.85
R9408:Tep1	UTSW	14	50837180	missense	possibly damaging	0.85
R9445:Tep1	UTSW	14	50845510	missense	possibly damaging	0.95
R9487:Tep1	UTSW	14	50829230	missense	possibly damaging	0.93
R9555:Tep1	UTSW	14	50868431	missense	not run
R9597:Tep1	UTSW	14	50863008	missense	not run
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATCAGCCAGGAGATAAGGCTCTGC -3'
(R):5'- TCTGTGTTTCGGGGAAGGACACAAG -3'

Sequencing Primer
(F):5'- CCCTGAAACTTTGTACTAGAGTCG -3'
(R):5'- TTTCGGGGAAGGACACAAGATTAC -3'

Posted On

2014-01-29