Mutagenetix > Incidental Mutations

Incidental Mutation 'R1263:Tonsl'

151679

Institutional Source

Beutler Lab

Gene Symbol

Tonsl

Ensembl Gene

ENSMUSG00000059323

Gene Name

tonsoku-like, DNA repair protein

Synonyms

Nfkbil2, 2810439M11Rik

MMRRC Submission

039330-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76626002-76639958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76622562 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 115 (I115F)

Ref Sequence

ENSEMBL: ENSMUSP00000155847 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078803] [ENSMUST00000168185] [ENSMUST00000229019]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078803
AA Change: I153F

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077856
Gene: ENSMUSG00000115987
AA Change: I153F

Domain	Start	End	E-Value	Type
Pfam:VPS28	39	219	2.2e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163990

Predicted Effect

probably benign
Transcript: ENSMUST00000165163

SMART Domains

Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
low complexity region	33	51	N/A	INTRINSIC
low complexity region	52	62	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168185

SMART Domains

Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	7e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
Pfam:TPR_8	242	274	8.7e-3	PFAM
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART
low complexity region	413	437	N/A	INTRINSIC
low complexity region	465	494	N/A	INTRINSIC
low complexity region	500	511	N/A	INTRINSIC
ANK	528	559	8.36e1	SMART
ANK	561	590	4.85e-8	SMART
ANK	597	626	2.85e-5	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	729	753	N/A	INTRINSIC
low complexity region	1031	1044	N/A	INTRINSIC
LRR	1058	1085	2.86e-1	SMART
LRR	1086	1113	5.88e-1	SMART
LRR	1117	1144	1.67e-2	SMART
LRR	1177	1204	2.72e0	SMART
LRR	1236	1263	7.02e0	SMART
LRR	1264	1292	1.46e2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229019
AA Change: I115F

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229052

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229261

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229545

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,620,278	Y207*	probably null	Het
Abca8b	A	C	11: 109,941,607	H1231Q	possibly damaging	Het
Acbd4	T	A	11: 103,103,851		probably null	Het
Atp13a4	T	A	16: 29,471,953	Y226F	possibly damaging	Het
Brd3	A	C	2: 27,462,522	F132C	probably damaging	Het
Btaf1	A	T	19: 36,956,524	N184I	probably benign	Het
Ccdc180	A	G	4: 45,903,887	E351G	possibly damaging	Het
Ccdc185	A	T	1: 182,747,353	Y590*	probably null	Het
Chil1	G	A	1: 134,189,242	E315K	probably benign	Het
Col6a6	T	A	9: 105,709,489	M1778L	probably benign	Het
Cyp3a59	A	C	5: 146,104,711	Y355S	probably damaging	Het
Cyp4a31	A	G	4: 115,574,711	T396A	probably benign	Het
Dnah6	A	T	6: 73,144,965	I1373N	probably damaging	Het
Dopey2	C	A	16: 93,777,386	H1598N	probably benign	Het
Erich4	T	A	7: 25,615,134	K118M	probably damaging	Het
Gkap1	A	T	13: 58,255,773	V179E	probably benign	Het
Gpr107	T	G	2: 31,178,255	I243S	possibly damaging	Het
Hs3st6	A	G	17: 24,758,530	N328S	probably damaging	Het
Kcnq5	A	T	1: 21,479,378	I375N	probably damaging	Het
Klhdc3	A	T	17: 46,676,966	H266Q	probably benign	Het
Krt71	C	T	15: 101,735,466	G446R	probably damaging	Het
L3mbtl2	A	G	15: 81,682,968	T423A	probably benign	Het
Mical3	T	C	6: 120,952,469	E1812G	probably damaging	Het
Nlrp1a	A	G	11: 71,097,122	I1174T	probably benign	Het
Npas2	C	A	1: 39,334,768	Q450K	possibly damaging	Het
Nrp1	T	A	8: 128,468,389	I442N	probably damaging	Het
Olfr1385	A	T	11: 49,495,021	M163L	probably benign	Het
Olfr338	T	A	2: 36,376,994	S73T	probably damaging	Het
Palld	TGCGTAGCG	TGCG	8: 61,513,457		probably null	Het
Pih1d3	A	T	1: 31,223,215	I93F	probably damaging	Het
Pold3	T	A	7: 100,119,683	Q36L	possibly damaging	Het
Polg	T	C	7: 79,459,786	T428A	probably benign	Het
Rfx7	T	A	9: 72,577,047	V57E	possibly damaging	Het
Rnf122	T	G	8: 31,112,149	M1R	probably null	Het
Scn10a	T	A	9: 119,617,733	T1410S	probably damaging	Het
Serpinb13	T	A	1: 107,000,736	V362E	probably damaging	Het
Setdb1	T	C	3: 95,327,611	N927S	probably damaging	Het
Sft2d1	A	G	17: 8,320,638	K91R	probably benign	Het
Shprh	A	G	10: 11,159,530	H327R	probably damaging	Het
Slc9b2	C	A	3: 135,336,395	H478Q	probably benign	Het
Styxl1	G	T	5: 135,753,883	S117R	probably damaging	Het
Synj2	T	C	17: 6,019,359	F150L	probably damaging	Het
Tep1	C	A	14: 50,845,513	V1013L	possibly damaging	Het
Tgfbi	T	A	13: 56,630,655	L413Q	probably damaging	Het
Tmc5	G	A	7: 118,666,870	R789Q	probably damaging	Het
Trim38	A	G	13: 23,791,134	Y352C	probably damaging	Het
Txnl4a	T	A	18: 80,207,321	V44D	probably benign	Het
Vars2	A	G	17: 35,661,609	V39A	probably damaging	Het
Vmn2r105	A	G	17: 20,208,322	C831R	probably damaging	Het
Vmn2r26	T	A	6: 124,050,708	I469N	probably benign	Het
Vmn2r53	T	C	7: 12,581,606	Y762C	probably benign	Het
Vps13d	T	A	4: 145,170,348	Q334L	probably benign	Het
Zfp277	A	T	12: 40,364,165	I227N	probably damaging	Het

Other mutations in Tonsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tonsl	APN	15	76638496	missense	possibly damaging	0.78
IGL00763:Tonsl	APN	15	76633868	missense	probably damaging	1.00
IGL00796:Tonsl	APN	15	76625149	missense	probably benign
IGL00965:Tonsl	APN	15	76631880	splice site	probably benign
IGL01434:Tonsl	APN	15	76631102	missense	probably benign	0.11
IGL01859:Tonsl	APN	15	76634780	missense	probably damaging	0.97
IGL02112:Tonsl	APN	15	76633402	missense	probably benign	0.01
IGL02189:Tonsl	APN	15	76623178	missense	possibly damaging	0.56
IGL02281:Tonsl	APN	15	76634074	missense	probably damaging	1.00
IGL02627:Tonsl	APN	15	76634095	missense	probably damaging	0.99
IGL02750:Tonsl	APN	15	76633389	missense	probably damaging	0.97
IGL02977:Tonsl	APN	15	76632873	missense	probably benign	0.00
R0127:Tonsl	UTSW	15	76633485	missense	probably benign	0.01
R0316:Tonsl	UTSW	15	76629300	missense	possibly damaging	0.68
R0443:Tonsl	UTSW	15	76639684	missense	probably benign
R0714:Tonsl	UTSW	15	76633721	splice site	probably benign
R0946:Tonsl	UTSW	15	76623221	missense	probably benign	0.03
R0975:Tonsl	UTSW	15	76638932	missense	probably damaging	0.99
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1610:Tonsl	UTSW	15	76638557	missense	probably damaging	1.00
R1623:Tonsl	UTSW	15	76638509	missense	probably damaging	1.00
R1763:Tonsl	UTSW	15	76638066	missense	probably damaging	1.00
R1882:Tonsl	UTSW	15	76624150	missense	possibly damaging	0.83
R1898:Tonsl	UTSW	15	76638853	splice site	probably null
R1932:Tonsl	UTSW	15	76624597	missense	probably damaging	0.97
R2141:Tonsl	UTSW	15	76632661	missense	probably damaging	0.99
R2166:Tonsl	UTSW	15	76637313	missense	probably benign	0.13
R2191:Tonsl	UTSW	15	76632680	missense	probably damaging	0.96
R2198:Tonsl	UTSW	15	76636672	missense	probably benign	0.00
R2219:Tonsl	UTSW	15	76634640	missense	probably damaging	1.00
R2762:Tonsl	UTSW	15	76630620	missense	probably damaging	1.00
R3156:Tonsl	UTSW	15	76639521	missense	probably damaging	1.00
R3508:Tonsl	UTSW	15	76639756	missense	probably benign
R4012:Tonsl	UTSW	15	76637044	missense	probably damaging	1.00
R4179:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4180:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4327:Tonsl	UTSW	15	76639716	missense	probably benign
R4627:Tonsl	UTSW	15	76637224	missense	probably damaging	1.00
R4671:Tonsl	UTSW	15	76623410	missense	probably benign	0.01
R4825:Tonsl	UTSW	15	76633248	missense	probably benign	0.34
R4840:Tonsl	UTSW	15	76633209	missense	probably benign
R5030:Tonsl	UTSW	15	76638101	missense	probably damaging	1.00
R5143:Tonsl	UTSW	15	76636657	missense	possibly damaging	0.80
R6238:Tonsl	UTSW	15	76636218	splice site	probably null
R6379:Tonsl	UTSW	15	76629742	missense	probably benign
R6401:Tonsl	UTSW	15	76633666	missense	probably damaging	1.00
R6534:Tonsl	UTSW	15	76629677	missense	probably damaging	1.00
R6695:Tonsl	UTSW	15	76629818	missense	possibly damaging	0.84
R6701:Tonsl	UTSW	15	76629300	missense	probably damaging	1.00
R7138:Tonsl	UTSW	15	76634776	missense	probably benign
R7206:Tonsl	UTSW	15	76633651	missense	probably damaging	1.00
R7287:Tonsl	UTSW	15	76633725	splice site	probably null
R7615:Tonsl	UTSW	15	76630607	missense	probably benign	0.44
R7626:Tonsl	UTSW	15	76633936	missense	probably null	1.00
R7641:Tonsl	UTSW	15	76633652	missense	probably damaging	1.00
R7920:Tonsl	UTSW	15	76634587	missense	probably damaging	1.00
R8245:Tonsl	UTSW	15	76636822	missense	probably benign	0.10
R8311:Tonsl	UTSW	15	76633263	missense	probably benign
Z1177:Tonsl	UTSW	15	76636153	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GCATCTGGCGAACTTGAGAGTCATC -3'
(R):5'- TTGGCCTACAAGCTATCCCCACTG -3'

Sequencing Primer
(F):5'- TGAGAGTCATCCAGCTCGTC -3'
(R):5'- GCTATCCCCACTGAGTAAGAGATG -3'

Posted On

2014-01-29