Incidental Mutation 'R1263:Krt71'
ID 151681
Institutional Source Beutler Lab
Gene Symbol Krt71
Ensembl Gene ENSMUSG00000051879
Gene Name keratin 71
Synonyms Cu, mK6irs, Krt2-6g, mK6irs1, Ca, Cal4
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock # R1263 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101733949-101743109 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101735466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 446 (G446R)
Ref Sequence ENSEMBL: ENSMUSP00000023710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023710]
AlphaFold Q9R0H5
Predicted Effect probably damaging
Transcript: ENSMUST00000023710
AA Change: G446R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023710
Gene: ENSMUSG00000051879
AA Change: G446R

low complexity region 17 55 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.6e-20 PFAM
Filament 130 443 1.19e-151 SMART
low complexity region 449 465 N/A INTRINSIC
Meta Mutation Damage Score 0.1934 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations in this gene result in waved hair and curly vibrissae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Txnl4a T A 18: 80,207,321 V44D probably benign Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Krt71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Krt71 APN 15 101736674 missense probably damaging 1.00
IGL03076:Krt71 APN 15 101734597 missense probably benign 0.00
IGL03390:Krt71 APN 15 101734552 missense possibly damaging 0.93
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0041:Krt71 UTSW 15 101739318 missense probably damaging 1.00
R0153:Krt71 UTSW 15 101734706 missense possibly damaging 0.65
R0376:Krt71 UTSW 15 101738070 missense probably damaging 1.00
R0932:Krt71 UTSW 15 101736760 missense probably benign 0.20
R1646:Krt71 UTSW 15 101738764 splice site probably null
R1796:Krt71 UTSW 15 101742880 missense possibly damaging 0.68
R1954:Krt71 UTSW 15 101735466 nonsense probably null
R3001:Krt71 UTSW 15 101740471 splice site probably benign
R3793:Krt71 UTSW 15 101742910 missense probably damaging 1.00
R4236:Krt71 UTSW 15 101734694 missense probably benign 0.09
R4751:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R6445:Krt71 UTSW 15 101740340 missense probably benign 0.06
R7034:Krt71 UTSW 15 101738337 missense probably benign 0.41
R7036:Krt71 UTSW 15 101738337 missense probably benign 0.41
R7378:Krt71 UTSW 15 101738329 nonsense probably null
R7942:Krt71 UTSW 15 101735459 missense probably damaging 0.99
R7961:Krt71 UTSW 15 101735442 missense probably damaging 0.99
R8026:Krt71 UTSW 15 101738382 missense possibly damaging 0.66
R8131:Krt71 UTSW 15 101734706 missense possibly damaging 0.65
R8943:Krt71 UTSW 15 101736745 missense possibly damaging 0.95
R9017:Krt71 UTSW 15 101742665 missense possibly damaging 0.68
R9417:Krt71 UTSW 15 101738296 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gaggcagaatgatgaagatgaag -3'
Posted On 2014-01-29