Incidental Mutation 'R1263:Txnl4a'
ID151690
Institutional Source Beutler Lab
Gene Symbol Txnl4a
Ensembl Gene ENSMUSG00000057130
Gene Namethioredoxin-like 4A
SynonymsTxnl4, U5-15kDa, ENSMUSG00000057130, D18Wsu98e
MMRRC Submission 039330-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1263 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80206795-80223533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80207321 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 44 (V44D)
Ref Sequence ENSEMBL: ENSMUSP00000115320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025463] [ENSMUST00000025464] [ENSMUST00000125127] [ENSMUST00000127234] [ENSMUST00000145963]
Predicted Effect probably benign
Transcript: ENSMUST00000025463
SMART Domains Protein: ENSMUSP00000025463
Gene: ENSMUSG00000024571

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 7.1e-8 PFAM
Pfam:Acetyltransf_7 40 130 2e-9 PFAM
Pfam:Acetyltransf_1 46 129 6.1e-18 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025464
AA Change: V44D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025464
Gene: ENSMUSG00000057130
AA Change: V44D

DomainStartEndE-ValueType
Pfam:DIM1 4 93 4.1e-49 PFAM
Pfam:Thioredoxin 8 91 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125127
SMART Domains Protein: ENSMUSP00000123193
Gene: ENSMUSG00000024571

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 40 129 2.3e-9 PFAM
Pfam:Acetyltransf_1 46 129 1e-17 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126360
Predicted Effect probably benign
Transcript: ENSMUST00000127234
SMART Domains Protein: ENSMUSP00000121883
Gene: ENSMUSG00000024571

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 7.1e-8 PFAM
Pfam:Acetyltransf_7 40 130 2e-9 PFAM
Pfam:Acetyltransf_1 46 129 6.1e-18 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145116
Predicted Effect probably benign
Transcript: ENSMUST00000145963
AA Change: V44D

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115320
Gene: ENSMUSG00000057130
AA Change: V44D

DomainStartEndE-ValueType
Pfam:DIM1 4 136 3.4e-73 PFAM
Pfam:Thioredoxin 8 109 3.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156400
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,278 Y207* probably null Het
Abca8b A C 11: 109,941,607 H1231Q possibly damaging Het
Acbd4 T A 11: 103,103,851 probably null Het
Atp13a4 T A 16: 29,471,953 Y226F possibly damaging Het
Brd3 A C 2: 27,462,522 F132C probably damaging Het
Btaf1 A T 19: 36,956,524 N184I probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Ccdc185 A T 1: 182,747,353 Y590* probably null Het
Chil1 G A 1: 134,189,242 E315K probably benign Het
Col6a6 T A 9: 105,709,489 M1778L probably benign Het
Cyp3a59 A C 5: 146,104,711 Y355S probably damaging Het
Cyp4a31 A G 4: 115,574,711 T396A probably benign Het
Dnah6 A T 6: 73,144,965 I1373N probably damaging Het
Dopey2 C A 16: 93,777,386 H1598N probably benign Het
Erich4 T A 7: 25,615,134 K118M probably damaging Het
Gkap1 A T 13: 58,255,773 V179E probably benign Het
Gpr107 T G 2: 31,178,255 I243S possibly damaging Het
Hs3st6 A G 17: 24,758,530 N328S probably damaging Het
Kcnq5 A T 1: 21,479,378 I375N probably damaging Het
Klhdc3 A T 17: 46,676,966 H266Q probably benign Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
L3mbtl2 A G 15: 81,682,968 T423A probably benign Het
Mical3 T C 6: 120,952,469 E1812G probably damaging Het
Nlrp1a A G 11: 71,097,122 I1174T probably benign Het
Npas2 C A 1: 39,334,768 Q450K possibly damaging Het
Nrp1 T A 8: 128,468,389 I442N probably damaging Het
Olfr1385 A T 11: 49,495,021 M163L probably benign Het
Olfr338 T A 2: 36,376,994 S73T probably damaging Het
Palld TGCGTAGCG TGCG 8: 61,513,457 probably null Het
Pih1d3 A T 1: 31,223,215 I93F probably damaging Het
Pold3 T A 7: 100,119,683 Q36L possibly damaging Het
Polg T C 7: 79,459,786 T428A probably benign Het
Rfx7 T A 9: 72,577,047 V57E possibly damaging Het
Rnf122 T G 8: 31,112,149 M1R probably null Het
Scn10a T A 9: 119,617,733 T1410S probably damaging Het
Serpinb13 T A 1: 107,000,736 V362E probably damaging Het
Setdb1 T C 3: 95,327,611 N927S probably damaging Het
Sft2d1 A G 17: 8,320,638 K91R probably benign Het
Shprh A G 10: 11,159,530 H327R probably damaging Het
Slc9b2 C A 3: 135,336,395 H478Q probably benign Het
Styxl1 G T 5: 135,753,883 S117R probably damaging Het
Synj2 T C 17: 6,019,359 F150L probably damaging Het
Tep1 C A 14: 50,845,513 V1013L possibly damaging Het
Tgfbi T A 13: 56,630,655 L413Q probably damaging Het
Tmc5 G A 7: 118,666,870 R789Q probably damaging Het
Tonsl T A 15: 76,622,562 I115F possibly damaging Het
Trim38 A G 13: 23,791,134 Y352C probably damaging Het
Vars2 A G 17: 35,661,609 V39A probably damaging Het
Vmn2r105 A G 17: 20,208,322 C831R probably damaging Het
Vmn2r26 T A 6: 124,050,708 I469N probably benign Het
Vmn2r53 T C 7: 12,581,606 Y762C probably benign Het
Vps13d T A 4: 145,170,348 Q334L probably benign Het
Zfp277 A T 12: 40,364,165 I227N probably damaging Het
Other mutations in Txnl4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Txnl4a APN 18 80218741 missense probably benign 0.02
IGL02349:Txnl4a APN 18 80218729 missense probably damaging 1.00
R1256:Txnl4a UTSW 18 80207272 missense probably benign 0.07
R1381:Txnl4a UTSW 18 80207264 missense probably benign 0.01
R4165:Txnl4a UTSW 18 80222256 missense probably benign 0.28
R4166:Txnl4a UTSW 18 80222256 missense probably benign 0.28
R4836:Txnl4a UTSW 18 80222253 missense probably damaging 1.00
R4903:Txnl4a UTSW 18 80207278 missense probably damaging 0.98
R6026:Txnl4a UTSW 18 80207267 missense probably damaging 0.98
R6275:Txnl4a UTSW 18 80218765 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCAGCGCCGAAAAGCGTCA -3'
(R):5'- TCTAGCACAAACCTTGCCCGTACAT -3'

Sequencing Primer
(F):5'- CTCACACGAGGTTAGAGGTC -3'
(R):5'- TTGCCCGTACATGAACCC -3'
Posted On2014-01-29